1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
makkiz [27]
3 years ago
9

Enzymes are used in moving sections of DNA that code for insulin from the pancreas cells of humans into a certain type of bacter

ial cell. This bacterial cell will reproduce, giving rise to offspring that are able to form:_____________
Biology
1 answer:
victus00 [196]3 years ago
6 0

Answer:

Human insulin

Explanation:

The process where by region of a DNA that codes for a particular function is transferred between organisms into cells Is described as gene transfer. This process can be used to enhance the mechanism of producing a gene that is not originally present in such organisms before. Therefore if the gene that code for insulin is inserted into a bacterial vector , the offspring of such bacteria will be able to synthesize insulin in their cell

You might be interested in
How do biologists use genetic engineering to build recombinant DNA?
coldgirl [10]

they combine the DNA of two different organims.

Explanation:

they join together genetic material especially the DNA from different biological species

8 0
2 years ago
Which is the correct order of processes that occur for water to move from a lake to a cloud and then turn into rain?
Mumz [18]
The cycle that is described in the problem is called the water cycle. in this cycle, the water from a lake is evaporated through the heat of the sun and the water is accumulated in the clouds. When the clouds are saturated, then water condenses and precipitates to fall as rain.
4 0
3 years ago
For which types of microbes would a microbiologist employ living host cells to support their growth?
Genrish500 [490]

Answer:

Correct Answer is Viruses

Explanation:

Viruses are non-cellular entities that consist of a nucleic acid nucleus (DNA or RNA) surrounded by a protein layer. Although viruses are classified as bacteria, they are not considered living organisms. The microbes such as viruses cannot reproduce outside a host cell and cannot metabolize on their own. Viruses often infest prokaryotic and eukaryotic cells that cause disease.

8 0
3 years ago
Arteries have thin walls why​
____ [38]
1st of all arteries have a thick walls while veins have have a thin wall

Answer to why arteries have thick walls: arteries have thick walls because blood flows inside them with high pressure and with a high speed
6 0
3 years ago
Read 2 more answers
What would happen to the size of the herbivore population if the producers population decreased?
yKpoI14uk [10]
Producers are the plants of the food chain. They use the sun or other inorganic energy sources as a way to make food for themselves.

5 0
3 years ago
Read 2 more answers
Other questions:
  • Why is diffusion important to cells?
    9·2 answers
  • A dog Gave birth to four puppies. the father has brown eyes, and the mother has grren eyes. Two puppies have brown eyes. one has
    15·1 answer
  • Bacteriophages infect
    10·1 answer
  • Look at the position of Location 1, Location 2, and Location 3 on a mountain.
    15·2 answers
  • Not all countries have adopted air quality regulations as America has. What impact on human health would these countries experie
    11·1 answer
  • How does one determine when an ecosystem is in balance
    7·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • State two factors on which the gravitational force between two objects depends.​
    11·1 answer
  • Well i just found out that my mom has coronavirus and my dad got exposed to it and he got home yesterday and my mom took the tes
    6·2 answers
  • Integrated Science
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!