1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Orlov [11]
3 years ago
6

Which of the following best explains what would happen if there were no decomposers in an ecosystem?

Biology
1 answer:
azamat3 years ago
5 0

Answer:  if there were no decomposers in an ecosystem then, wastes and the remains of dead organisms would pile up and the nutrients within the waste and dead organisms would not be released back into the ecosystem.

Explanation:

You might be interested in
Moving substances from a lower concentration to a higher concentration requires _____ ?
e-lub [12.9K]
The answer is Active transport
5 0
3 years ago
Read 2 more answers
On a sunny day at an open market a vendor, Ms. Milly, occasionally sprinkles water on her wilting lettuce. During the day Ms. Mi
stellarik [79]

The process that results in Ms. Milly’s wilting lettuce becoming firm is osmosis. The explanation is below.

OSMOSIS:

  • Osmosis is the process by which water molecules move from a region of high concentration to a region of low concentration via a semipermeable membrane.

  • According to this question, Ms. Milly, occasionally sprinkles water on her wilting lettuce and notices that they became firm.

  • The firmness of the lettuce is as a result of the movement of water into the leaf cells due to a process called osmosis.

Learn more at: brainly.com/question/13655668?referrer=searchResults

8 0
2 years ago
Read 2 more answers
The surgical repair of a vessel is _____.
umka2103 [35]
I believe it’s angioplasty. 95% sure. Good luck
5 0
3 years ago
You have discovered an unknown organism 'X' belonging to the kingdom animalia. what steps would you take to classify this organi
anygoal [31]

Explanation:

<h3>  Possesses a well-developed brain and a vertebral column with eyes at the front of its head, -         Possesses a four chambered heart and lays eggs, -         It is an aboral herbivore, with a row of spines running down its back to its tail. Classify organism ‘A’ into is corresponding Phylum, Class and Genus. State clearly the features .</h3>
7 0
2 years ago
How does cactus survive without leaves<br>​
AveGali [126]
Thus, Cactus survive with the help of its "green stems" and "transpiration".
7 0
2 years ago
Other questions:
  • Uniden's condition is an X-linked recessive trait in the Redialer population. The trait allele F has a frequency of 0.005 in thi
    12·1 answer
  • On the surface of the earth, the force of gravity acting on one kilogram is: _________ newton’s
    13·1 answer
  • How are earthquakes and volcanoes similar or related and how are they different? please help essay due tomorrow
    13·1 answer
  • Stomatas are pores on the plant leaf that
    9·1 answer
  • What type of connective tissue is found only in the umbilical cord?
    12·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • A group of college students working on a project on bio-gas have found some bacteria in the bio-gas plant. These bacteria can ut
    9·1 answer
  • ❗️❗️EARTH SCIENCE CLASS ❗️❗️Climate factors are the things that established and have changed the Earths climate for billions of
    13·1 answer
  • Which of the following substances would be transported by exocytosis?
    6·1 answer
  • What part of the body does cancer generally affect?
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!