Answer: Interventional Study
Explanation: When a treatment group is compared to standard (control) group it is called Interventional Study
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer: Option D " all of the above "
Explanation: DNA can be a great source of information when used as a forensic evidence. This technique has many advantages and disadvantages when used as a source of information in case of crime.
Identical twins: There are some common fragments of DNA that is same in identical twins so it can be a difficulty in deciding the criminal.
Not enough of a sample: DNA should be present in a detectable amount to be used an sample for evidence, less than this detectable amount is a waste and cannot be used as a sample for evidence.
Contaminated and degraded sample: If the sample of DNA is contaminated or degraded then the result might be incorrect and might not be used as a sample for forensic evidence.
Hence, the correct answers are all of the above.
Answer:
C6H12O6 + 6O2-> 6CO2 + 6H2O
Blueberry: 1st Trophic Level
Rabbit: 2nd Trophic Level
Snake: 3rd Trophic Level
Cat: 4th Trophic Level
Hope this helps :P
plz give me the brainliest if it does : )
