1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lions [1.4K]
3 years ago
10

The process by which a neurotransmitter is reabsorbed by the neuron that released it is termed:

Biology
1 answer:
liq [111]3 years ago
5 0
The answer is <span>Reuptake.
Have a nice day :-)</span>
You might be interested in
1pt Place the following steps in the correct order:
Hoochie [10]

Answer:

The delivery of the paternal genome to the egg is a primary goal of fertilization. In preparation for this step, the nucleus of the developing spermatozoon undergoes extensive morphological and biochemical transformations during spermatogenesis to yield a tightly compacted sperm nucleus. These modifications are essentially reversed during fertilization. As a result, the incorporated sperm nucleus undergoes many steps in the egg cytoplasm as it develops into a male pronucleus. The sperm nucleus (1) loses its nuclear envelope, (2) undergoes nucleoprotein remodeling, (3) decondenses and increases in size, (4) becomes more spherical, (5) acquires a new nuclear envelope, and (6) becomes functionally competent to synthesize DNA and RNA. These changes are coordinate with meiotic processing of the maternal chromatin, and often result in behaviors asynchronous with the maternal chromatin. For example, in eggs fertilized during meiosis, the sperm nucleus decondenses while the maternal chromatin remains condensed. A model is presented that suggests some reasons why this puzzling behavior exists. Defects in any of the processes attending male pronuclear development often result in infertility. New assisted reproductive technologies have been developed that ensure delivery of the sperm nucleus to the egg cytoplasm so that a healthy embryo is produced. An emerging challenge is to further characterize the molecular mechanisms that control sperm nuclear transformations and link these to causes of human infertility. Further understanding of this basic process promises to revolutionize our understanding of the mystery of the beginning of new life.

Explanation:

The delivery of the paternal genome to the egg is a primary goal of fertilization. In preparation for this step, the nucleus of the developing spermatozoon undergoes extensive morphological and biochemical transformations during spermatogenesis to yield a tightly compacted sperm nucleus. These modifications are essentially reversed during fertilization. As a result, the incorporated sperm nucleus undergoes many steps in the egg cytoplasm as it develops into a male pronucleus.

4 0
3 years ago
Which example listed below is not a population?
Alja [10]

Answer:

D. all the sunshine in a lake

8 0
3 years ago
Read 2 more answers
The spindle apparatus disintegrates during _____. anaphase telophase interphase metaphase
IRINA_888 [86]

Answer;

-Telophase

Explanation;

-The spindle apparatus disintegrates during the telophase of mitosis. Telophase is the final stage of mitosis.

-During this phase, the sister chromatids reach opposite poles. The small nuclear vesicles in the cell begin to re-form around the group of chromosomes at each end.

-As the nuclear envelope re-forms by associating with the chromosomes, two nuclei are created in the one cell. Telophase is also marked by the dissolution of the kinetochore microtubules and the continued elongation of the polar microtubules.

6 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
BEAKER 4
NikAS [45]

Answer:

more glucose and change to a blacky-purple colour

Explanation:

7 0
3 years ago
Other questions:
  • True or False A parasite having no intermediate host is liverfluke.
    11·1 answer
  • Help pls asap <br>name the cell part
    9·1 answer
  • Which biome is most suitable for raising crops such as corn, wheat, and oats?
    8·2 answers
  • Which would make for a weak claim?
    10·2 answers
  • Each item can be a source of indoor air pollution except
    15·1 answer
  • What would happen if our atmosphere consisted of pure oxygen
    15·1 answer
  • Which of the following biomes is located just below the arctic circle and is characterized by tall pine trees and extremely cold
    5·2 answers
  • Each axial filament is made up of fibrils identical in structure to A. cilia.B. pili.C. flagella.D. pseudopods.
    12·1 answer
  • Which cell molecules will be used to make viral proteins
    9·1 answer
  • PLEASE HELP !! ILL GIVE 40 POINTS ; PLUS BRAINLIEST !! DONT SKIP ANSWER.
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!