1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Firdavs [7]
3 years ago
10

Which best describes a role of animals in the water cycle? a. They help water vapor condense when they produce waste. b. They he

lp water vapor condense when they inhale. c. They release water vapor through transpiration. d. They release water vapor when they exhale.
Biology
2 answers:
KengaRu [80]3 years ago
8 0

Answer:

d. They release water vapor when they exhale.

Explanation:

Water cycle is also known as the hydrologic cycle. water cycle is the circulation of water in the earth atmosphere system. Water cycle describes the continuous movement of water on the earth, above the earth and below the earth.

Water move through the earth-atmosphere system by different process like condensation, evaporation, transpiration, infiltration and many more process. Water evaporates to the atmosphere through surface water like oceans, lake,sea etc by process of evaporation.

Animals contributes to the process of water cycles by breathing and urination. Animals exhales  more water vapor than they inhale and this contribute to the water cycle. They also contribute to the water cycle by urinating.  

Illusion [34]3 years ago
3 0

Answer:D. they release water vapor when they exhale.

Explanation:The water cycle can be described as the cycle of different processes by which the water circulates between the ocean, atmosphere, and the land.

You might be interested in
When a wave in the ocean travels toward the beach, why does a floating seagull not get pulled with it?
Arturiano [62]

Answer:

maybe do B, not all of the same water molecules travel with the same wave

Explanation:

6 0
3 years ago
Read 2 more answers
Cervical pregnancies are extremely rare. Women undergoing cervical pregnancies often experience unusual vaginal bleeding. In ext
Alchen [17]

Answer:

Ectopic pregnancy can cause the burst of fallopian tube. If previous ectopic pregnancy occured then again onset of this type of pregnancy may lead to life threatening bleeding. Having the abdominal surgery before may also proved as a risk.

6 0
3 years ago
Read 2 more answers
Do fungi have chloroplasts?
lina2011 [118]
No all fungi do not have chloropasts..............


6 0
3 years ago
N the Watson-Crick model of DNA, the two strands of the double helix are united by hydrogen bonds between
horrorfan [7]
B double helix and linked with hydrogen bonds
8 0
3 years ago
Carl is counting the number of bones in a human skeleton. He counted 198 bones. There are actually 206 bones in the human body.
vazorg [7]

Answer: The percent error is 3.88%

Explanation:

Percent error = [(Actual bones - Counted bones)/ Actual bones] X 100%

= [(206 - 198)/206] X 100%

= [8/206] X 100%

= 3.88%

Thus, Carl's percent error is 3.88%

7 0
3 years ago
Other questions:
  • Early, flawed dna models proposed by watson and crick and by linus pauling correctly described which property of dna? early, fla
    12·1 answer
  • White vinegar is an alternative cleaning product that helps:
    6·2 answers
  • What is the primary objective in a telescope? What two materials can it be<br> made of?
    7·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • I have type "A" blood. Which of these can I NOT get blood from? (check all that apply)
    7·1 answer
  • Please helpp in timed test! giving brainliest!!!! 15pts
    14·1 answer
  • Differences between reducing sugars and non reducing sugars​
    15·1 answer
  • List the features of a flower that ensure pollination will take place at some point.
    7·1 answer
  • Which number best represents the mitochondria​
    5·1 answer
  • Please help me thankyou​
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!