1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Hatshy [7]
3 years ago
15

I need help finishing this chart and checking if I put the answers/possible answers in the right place.

Biology
1 answer:
Nastasia [14]3 years ago
4 0
They all look right to me sorry if you get any wrong...
You might be interested in
What causes sediments to stick together and become sold rock?
zzz [600]

Answer:

C. pressure is correct

Explanation:

7 0
3 years ago
Read 2 more answers
Which is a change early farmers made to their environment? A. They planted orchards. B. They burned undergrowth. C. They created
tatuchka [14]
B, they burned undergrowth
7 0
3 years ago
Can you explain how more life-forms were able to create because of cyanobacteria​ PLEASE HELP
Ainat [17]

The cyanobacteria changed the composition of the earth’s atmosphere by evolving oxygen in what is referred to as the Great Oxygenation Event. This also allowed the ozone to be formed and block off most of the UV rays that are destructive to genetic material. Life was, therefore, also able to exist on land other than in water.

8 0
3 years ago
It is a polymer that tesist all kinds of environmental damages? A.sapropollenin B.waxes C.cuticle D.lignin
Bad White [126]
sapropollenin i<span>s a polymer that tesist all kinds of environmental damages</span>
7 0
3 years ago
Sometimes, pregnant women are very emotional. This is believed to be caused by extra estrogen and progesterone that are released
Strike441 [17]

Activational effect is the correct answer.

Activational effect is an impermanent hormonal effect that leads to a change in physiological activity or behavior in both humans and adult animals. For instance, when testosterone levels rise in male songbirds they become more aggressive and tend to engage in courtship behavior. Also, a pregnant woman may get more emotional than usual due to an extra level of progesterone and estrogen during pregnancy.  

3 0
3 years ago
Other questions:
  • Which of these statements is the main reason smallpox was eradicated a.the smallpox virus only infects humans b.the virus is inh
    5·2 answers
  • How do biological organisms use energy?.
    10·2 answers
  • In general, life needs to maintain a pH level between____.<br> 0)1-4<br> 0)5-8<br> 0)9-14
    10·1 answer
  • Which best describes how scientists found the human gene that makes insulin
    9·2 answers
  • Need help emt class hard for me
    10·1 answer
  • Which explains why it is important to eat a full healthy meal before an afternoon of playing sports?
    11·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Let's look at the original hypotheses arising from the original question: "Does the size of the
    13·1 answer
  • Which organelle would not be found in a prokaryotic cell? A) nucleus b)cell membrane c)Cytoplasm d)Genetic material​
    12·1 answer
  • What does a plant need to create a glucose molecule in photosynthesis?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!