1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AleksandrR [38]
3 years ago
7

Ulnar deviation of the hand is also known as

Biology
2 answers:
gavmur [86]3 years ago
8 0

That is a really funny question in a way. In biology, everything that has a simple name has a more complex scientifical name, but that isn't the case here.

Ulnar deviation of the hand is also known as ulnar drift of the hand.



Hope it helped,


BioTeacher101

babymother [125]3 years ago
3 0

It's also known as ulnar drift.

You might be interested in
Grass clippings and other plant material can be returned to the environment for recycling if collected in a _____.
Lady bird [3.3K]
I think the answer is compost bin
4 0
3 years ago
Read 2 more answers
Alleles are alternate versions of _____ gene(s) that have ____ nucleotide sequences. A. the same; completely different B. the sa
12345 [234]

Answer:

Explanation:

when youre feelinsgs subside and shadows still remain

gons and ruse

5 0
3 years ago
Read 2 more answers
In complicated living things, such as human beings, cells have become________________ to perform different tasks
andriy [413]

Answer: multicellular

ExplanatioExplanationExplanatioExplanationnn:

8 0
2 years ago
You cross nonpure tall plants (Tt) and produce 200
anyanavicka [17]

Answer:

C is the best answer

Explanation:

the dominate trait is in 3 of the four boxes

6 0
3 years ago
Complete the sentence by selecting the correct answer. Darwin's idea of evolution suggested that…
lidiya [134]
I think it’s option B
I hope it helps you
3 0
3 years ago
Other questions:
  • In the northern hemisphere, pressure gradients and the coriolis effect applied to low pressure centers produce winds that blow..
    12·2 answers
  • Which of these is a living prokaryotic cell? a.)Virus b.)bacteria c.) amoeba d.) paramecium
    11·1 answer
  • What land features result from the forces of plate movement?
    9·2 answers
  • Please Help! What is the stimulus shown in the photographs?
    8·1 answer
  • Main function of lymphatic circulation is
    10·1 answer
  • What is the function of plants?
    13·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • A man travels 15 km east before turning around and heading 5 km west. What is his displacement?
    10·1 answer
  • What is NOT an important role of mitochondrial metabolism for accelerated cancer cell growth (you can choose multiple)
    7·1 answer
  • Which part of the cell theory refers to the flow of energy through a cell?to the flow of information through a cell?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!