1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aleksley [76]
3 years ago
6

I’m not sure what the answer is ??

Biology
2 answers:
PSYCHO15rus [73]3 years ago
7 0

Answer:

Few animals are adapted to withstand high-speed water.

Explanation:

rjkz [21]3 years ago
4 0

Answer:

Currents prevent accumulation of most organic matter

You might be interested in
Which event would require a scientific theory to be changed?
Alinara [238K]

B. Enough evidence is collected to contradict the theory.

This is because if data has been proven, the scientific theory must be changed since it is false.

6 0
1 year ago
Read 2 more answers
. Which type of air holds more water vapor?
LiRa [457]

Answer:

The maximum amount of water vapor that can be in the air depends on the air temperature. Warmer air can hold more water vapor within it. That's why the muggiest days usually happen at the height of summer heat. But as the temperature goes down, the air can hold less vapor and some of it turns into liquid water.

Hope it helps!!!

4 0
3 years ago
Read 2 more answers
One genetic engineering application that relies on transgenic organisms is the production of large quantities of a desired prote
LiRa [457]

Answer:

True

Explanation:

Restriction enzymes are molecular scissors. These endonucleases serve to cut the DNA at specific sequences called restriction sites. DNA ligases are the enzymes that link DNA fragments together. The DNA of the donor organisms (such as a human) is cut with restriction endonucleases at specific sites to produce a set of the smaller fragments.

The gene of the interest is isolated from these fragments. DNA sequence carrying the gene of the interest is joined to the suitable vector DNA molecule by using DNA ligases. This produces a recombinant vector that carries the gene of the interest into the host cell.

For example, restriction digestion of the human genome is followed by isolation of the human insulin gene from the restriction digestion fragments. The isolated gene is then ligated into the vector DNA using DNA ligases. The vector DNA is inserted into the host cell (such as bacterium <em>E. coli</em>) to produce a large amount of human insulin.

3 0
3 years ago
Need help ASAP !! Pleaseeeee
stich3 [128]

sry if m wrong..but im 75 percent sure its c

ANSWER C...

please tell me if im wrong

5 0
3 years ago
Definición de Ecología​
AlexFokin [52]
La rama de la biología que se ocupa de las relaciones de los organismos entre sí y con su entorno físico.
3 0
3 years ago
Other questions:
  • Suppose two independently assorting genes are involved in the pathway that determines fruit color in squash. these genes interac
    6·2 answers
  • What are 3 differences between the 3 types of macromolecules
    8·1 answer
  • The foundation for biological evolution or descent through modification is?
    14·2 answers
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • Many organisms could potentially provide new medicines for human use, making which of the following crucial?
    11·1 answer
  • Plants are members of the eukaryotic supergroup ________ , and their closest relatives are _________. Plants are members of the
    12·1 answer
  • Traditional analysis of mutants (natural or induced) to determine gene function is known as _____.
    14·1 answer
  • Which processes occur in a plant embryo before it pushes out of the soil? Check all that apply. 
    8·2 answers
  • Is cell division sexual asexual or both
    10·1 answer
  • YA'LL ARE SMART!<br> PLEASE HELP!
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!