1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alika [10]
2 years ago
11

What is transcription?

Biology
2 answers:
lisabon 2012 [21]2 years ago
6 0
The action or process of transcribing something
Tasya [4]2 years ago
5 0
A written or printed representation of something
You might be interested in
Many polyploid plants, such as the bananas shown here, are grown commercially because they are often larger and healthier than n
larisa [96]
The genetic mulation

7 0
3 years ago
Read 2 more answers
How can a species develope genetic diversity
xxTIMURxx [149]
Sexual reproduction results diversity
4 0
3 years ago
Assembling a complete sequence from fragment sequences
Soloha48 [4]

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

7 0
3 years ago
How are oxygen and ozone alike
viva [34]
Both are made only of oxygen atoms.
They are both gases kept at room temperature.
Both absorb UV-C and more energetic radiation of the Sun.
3 0
3 years ago
Please I need help immediately, describe an experiment to verify the living organisms in the soil.​
Alborosie

Answer:

Soil living organisms compromise from mammals (such as rats) to micro organisms (such as nematodes and protozoa). Soil organisms help in the modification of soil, and also in the decomposition of organic matter. However they can also pose as a treat to to some crops, as they are responsible for some plant diseases.

Explanation:

When living organisms breathe they give out carbon dioxide gas as a waste product. Carbon dioxide gas can be detected (identified) using a carbon dioxide indicator solution called bromothymol blue. To find out if there are living organisms present in the four different levels of soil takenfrom the deciduous forest.

6 0
2 years ago
Other questions:
  • Golgi apparatus non examples
    15·1 answer
  • Which sequence correctly traces the path of a protein in a cell
    7·2 answers
  • What effect might tectonic plate movement have on the size of an ocean basin
    7·1 answer
  • All the stars circled are the same size and give off the same amount of light. Which statement below do you agree with most? A.
    14·2 answers
  • 5. The Skinner box allows experimenters to test animals without having to "re-load" the experiment, allowing the trainer to rein
    13·1 answer
  • In Drosophila, the genes for body coloration and eye size are on different chromosomes. Normal-colored bodies are dominant to eb
    8·1 answer
  • Which statement correctly identifies structures 1 and 2 in the diagram?
    10·2 answers
  • Which is the best description of photo phosphorylation
    14·1 answer
  • Ayudaaaaaaaa por favorrr​
    11·2 answers
  • Consider the following prediction. Prediction: If tomato plants are harmed by NoGro herbicide, then an increase in the concentra
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!