Sexual reproduction results diversity
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Both are made only of oxygen atoms.
They are both gases kept at room temperature.
Both absorb UV-C and more energetic radiation of the Sun.
Answer:
Soil living organisms compromise from mammals (such as rats) to micro organisms (such as nematodes and protozoa). Soil organisms help in the modification of soil, and also in the decomposition of organic matter. However they can also pose as a treat to to some crops, as they are responsible for some plant diseases.
Explanation:
When living organisms breathe they give out carbon dioxide gas as a waste product. Carbon dioxide gas can be detected (identified) using a carbon dioxide indicator solution called bromothymol blue. To find out if there are living organisms present in the four different levels of soil takenfrom the deciduous forest.