1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Agata [3.3K]
3 years ago
6

Can someone help me please

Biology
1 answer:
kirill115 [55]3 years ago
4 0

D)


scientific theory is something that has been proven over many tests


Hope that helps

You might be interested in
The abiotic and biotic<br> factors of an area and their<br> interactions<br> [Choose<br> &gt;
grandymaker [24]

Answer:

Explanation:

It is D

7 0
3 years ago
When equipment malfunctions, a(n) _____ needs to be initiated.
tiny-mole [99]

Answer: Alarm

Explanation:

When equipment malfunctions, an alarm should be initiated to bring the malfunction to the attention of the relevant personnel.

This will ensure that whatever adverse effects the malfunction could have caused is mitigated and the machine can be attended to on time to prevent further damage.

7 0
3 years ago
What Is Systolic Blood Pressure?​
Daniel [21]

Answer:

It is the pressure when the heart pushes blood out . The number when pressure is checked written on the top is the systolic pressure of the heart .

Explanation:

Hope it helps you dear :)

Good afternoon !

7 0
3 years ago
Read 2 more answers
Which of the following is not a characteristic life
SSSSS [86.1K]

Answer: c, because everything is made of atoms but it’s not directly affiliated with life itself

Explanation:

3 0
4 years ago
Read 2 more answers
What happens if I recycle my plastic consumption for a week?
kotykmax [81]

Answer:

It will help the Earth.

Explanation:

4 0
3 years ago
Other questions:
  • The communication system in your body by which hormones influence thoughts, behaviors, and actions is the ________ system.
    5·1 answer
  • The pairing of chromosomes and the exchange of DNA between chromosomes is called crossing over, the diagram below illustrates th
    5·2 answers
  • A new gene is discovered that dramatically aids in the digestion of fish. you hypothesize that populations with a history of bei
    9·1 answer
  • The process of gene expression involves ____.
    15·1 answer
  • A rabbit taken from a meadow near sea level and moved to a meadow high on a mountainside would have some trouble breathing. why?
    12·1 answer
  • How are organisms grouped?<br> A. By genus<br> B. By family<br> C. By species
    15·1 answer
  • You would expect to find spores
    5·1 answer
  • Match each type of muscle tissue to the action it performs in the body.
    14·2 answers
  • What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct
    7·1 answer
  • From earliest to latest, the overall sequence of early development proceeds as follows: A) gastrulation → organogenesis → cleava
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!