1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mars2501 [29]
3 years ago
15

Genes contain intruction for assembling what

Biology
1 answer:
pochemuha3 years ago
5 0

Answer:

amino acids into proteins

Explanation:

Most genes contain instructions for assembling amino acids into proteins,which the proteins are also helping ribosomes.

You might be interested in
Which of the following explosive materials is available in commercial form as fertilizer?
Sveta_85 [38]
<span>ammonium nitrate is found in fertilizers</span>
3 0
3 years ago
I NEED HELP The measure of how resistant a solid is to shape change when a force is applied.
enyata [817]

<em>Hardness is a measure of how resistant solid matter is to various kinds of permanent shape change when a force is applied</em> <em>Macroscopic hardness is generally characterized by</em> <em>strong intermolecular bonds</em>, <em>but the behavior of solid materials under force is complex; therefore,</em> <em>there are different measurements of hardness</em>: <em>scratch hardness, indentation hardness, and rebound hardness. Hardness is dependent on ductility, elastic stiffness, plasticity, strain, strength, toughness, viscoelasticity, and viscosity. Common examples of hard matter are ceramics, concrete, certain metals, and super hard materials, which can be contrasted with soft matter.</em>

3 0
2 years ago
Raussaun has had a fever and some swelling lately. He is also very tired and itchy. After diagnosing Raussaun's illness, what tr
balu736 [363]
Taking corticosteroids
7 0
3 years ago
Read 2 more answers
How are viruses spread from cell to cell?
abruzzese [7]

Answer:

Replicate itself into the cell host

Explanation:

Visus is made from a protein capsule and inside a fragment of RNA. Sometimes they also have some feet of filament to get attached to the cellular membrane.

Once attached, the virus injects its RNA into the cytoplasm and travels to the nucleus and insert this fragment of RNA into the cell DNA and start making copies of itself.

When the cell is full of virus, the membrane breaks and releases all the new virus to the neighbor cells, and the process starts again.

7 0
3 years ago
What process occurs during cellular development as the cell changes into a specific type of cell with specialized functions?
Fudgin [204]

Answer: The answer is C which is differentiation

3 0
3 years ago
Read 2 more answers
Other questions:
  • Which process is part of the carbon cycle?
    10·2 answers
  • Many endangered species are predators that belong to the higher trophic levels. Which in the process the primarily affects anima
    7·2 answers
  • After what process does each daughter cell receives an exact copy of the parent cells DNA
    7·2 answers
  • Are enzymes made out of carbohydrates
    15·2 answers
  • Where does nitrogen from the atmosphere go before it enters a plant
    13·1 answer
  • Which part of the nucleotide codes for out traits?
    10·1 answer
  • A dinoflagellate is a microscopic organism that is very common in the ocean. It consists of a single cell and has a flagella tha
    13·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • A female mouse is trying to decide if she will leave her natal nest to reproduce alone. If she leaves, she will be able to produ
    15·1 answer
  • Name a body system that helps people to move?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!