1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
love history [14]
3 years ago
9

What is the best place to find the most recent developments in using lasers for surgical eye procedures?

Biology
2 answers:
irakobra [83]3 years ago
6 0
The eye doctor is the most recent developments in using lasers for surgical eye procedure
9966 [12]3 years ago
4 0

Answer:

Internet Search Engine

Explanation:

Text books and Dictionaries are not updated frequently and do not have the most recent developments. I do not think that Almanacs would give you that type of information.

You might be interested in
What is clearcutting?
liq [111]

Answer:

cut down and remove every tree from (an area)

Explanation:

hope that helps

4 0
2 years ago
What are protons. in your own words
Vinvika [58]

Answer:

a particle with a positive charge that is in the nucleus of an atom

Explanation:

3 0
2 years ago
Human red blood cells that lack sufficient hemoglobin would have a low amount of what substance?
lisabon 2012 [21]

If a human’s red blood cells will lack sufficient amount of hemoglobin, he or she would have also a low amount of oxygen.

Hemoglobin is what makes the red blood cells red in color, aside from the abnormal color, the red blood cells also make up of oxygen.  It can also be with iron since iron is bind to hemoglobin all the way to the lungs.

6 0
3 years ago
What information on a pedigree can tell you whether a gene is a autosome or a sex chromosome ???
My name is Ann [436]

Answer:

What information on a pedigree can tell you whether a gene is on a autosome or not a sex chromosome? If in a pedigree, the occurrence of the disorder is 50/50 between females and males, then it shows that it is autosomal. If the disorder is mostly shown in males then it is a sex-linked trait.

Explanation:

4 0
3 years ago
What type of divergent adaptation occurs when a small subpopulation enters a niche?
VikaD [51]
Parapatric speciation
3 0
3 years ago
Read 2 more answers
Other questions:
  • Identify the plant organs seen in the drawing.
    7·1 answer
  • Which one is different from this list: Lion, wolf, tiger, horse?
    8·2 answers
  • Personal values and work values cannot be related. ture or false?
    9·1 answer
  • Which characteristic is not necessary for survival of the organism but is needed for the survival of the species
    14·1 answer
  • compare the Venn diagram of sexual reproduction and asexual reproduction in plants. Where in the diagram would you add identical
    11·1 answer
  • The birth control pill is a good precaution against syphilis. <br> a. True <br> b. False
    14·2 answers
  • Causes and Solutions for Water pollution(Grade-7) ​
    9·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • I NEED HELPPPPPP
    9·2 answers
  • Is squids shooting out ink behavioral adaptation?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!