D a medium sized star because the largest star is canis majoris and the smallest star is brown dwarf..☺
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Answer:
Answer is C.
Explanation:
A. The vessel length is pretty much constant. The body can't length or shorten blood vessels.
B. Blood viscosity is also fairly constant because the composition of blood cannot change quickly enough to change resistance as needed.
C. This is the main way resistance is controlled. The smooth muscle surrounding blood vessels can rapidly respond to hormonal or metabolic stimuli and contract/relax to adjust diameter.
D. Again, temperature is fairly constant in the body and would not be a good way to alter resistance.
The new cells would have incorrect number of chromesomes
