1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nikdorinn [45]
3 years ago
7

Those who have positive qualities are often judged more positively on their other qualities.

Biology
2 answers:
tatuchka [14]3 years ago
7 0

True because people always try to see some bad in people nobodys perfect

jok3333 [9.3K]3 years ago
4 0

The answer is true to provided

You might be interested in
HELP ASAP WILL GIVE 10 POINTS PLEASEEE two populations of foxes are prevented from mating only because they live on two opposite
iragen [17]

Answer:

A geographic isolation

6 0
2 years ago
The presence of a meal in the stomach triggers an increase in the colonic motility and an increase in the frequency of mass move
34kurt

Answer: Gastrocholic reflex

Explanation:

The gastrocholic reflex or gastrocolic response is one of the physiological reflexes in the stomach  which controls the movements like peristalsis and motility in the gastrointestinal tract.

This reflex is generated by the the food particles that enters the stomach. The  bolus of the food in the stomach helps in the mass movement of the other food particles in the colon.

This reflex is known as gastrocholic reflex.

7 0
3 years ago
What does the dot at 47 represent?
Aleksandr-060686 [28]
The anser is b
The anser is d my bro
6 0
3 years ago
What's the word equation for photosynthesis​
pentagon [3]

Answer:

the photosynthesis equation is as follows:6CO2+6H20+(energy)-C6H1206+602

Carbon dioxide + water + energy from light produces glucose and oxygen

7 0
3 years ago
Read 2 more answers
Answer answer answer :)
sladkih [1.3K]

Answer:

Chromatin

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which can adapt to changes A. alleles B. population C. offspring D. individuals
    5·1 answer
  • Mutations are sometimes helpful in providing food for people. TrueFalse
    15·1 answer
  • What is the internal environment and explain how it is related to the inside of a cell, the interstitial fluid and to the outsid
    10·1 answer
  • A cell forms glycogen from simple sugars when food is plentiful. Which statement describes this process?
    11·1 answer
  • 1. Tom was seriously injured in a car crash. As a result, he had to have one of his kidneys removed. Does Tom need dialysis? Why
    9·1 answer
  • Explain how the results of the experiment show the major function of the integumentary system. and will make brainiest.
    7·1 answer
  • How does sequencing genes provide evidence for evolution
    11·2 answers
  • Many scientists worked together to form a realistic model of the structure of the DNA molecule.
    6·1 answer
  • Define carrying capacity with an example?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!