If a man who has Type O blood, his biological children cannot be type AB.
A man who has type O blood cannot father a child with type AB blood, because he did not pass on the type O blood allele to all of his offspring.
Answer:
Answered below
Explanation:
Whoosh is an inhibitor of the f1fo ATP synthase. ATP synthase is an enzyme that catalyses the synthesis of ATP in the mitochondria through the process of oxidative phosphorylation, by using energy from the transmembrane electrochemical proton gradient along the respiratory chain.
ATP synthase is made up of two main subunits called the F0 and F1. These subunits allow for ATP production through their rotational mechanisms.
Various synthetic and natural inhibitors of ATP synthase have been used to study the structure and mechanism of ATP synthase. These inhibitors cause the decrease in the NAD/NADH ratio. They include; polypeptides, organotin compounds, cationic inhibitors, amino acid modifiers, oligomycin and peptide inhibitors.
Answer:
The same
Explanation:
In mitosis, genetically identical daughter cells are created. In meiosis the number of chromosomes is half as many as the original cell
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
Position and movment are controlled and uncontrolled by climax or orgasms