All categories

3 years ago

When the single source of pollution can be identified, it is called ______.

Biology

1 answer:

Reika [66]3 years ago

8 0

Answer: <u>Option D point source pollution </u>

Explanation: The pollutants which can be tracked, from the source of origin are termed as point source pollution. This can be water source, air or even light or noise pollution. The pollutants are easily detected being released from the source of pollution. Whereas the non-point source of pollution are those which are indirect sources and they carry off the pollutants which lie on the way, like runoff water carrying the pesticides from the agricultural land. Runoff and waste are examples of non-point sources of pollution. Thus, option A and C are incorrect answers.

You might be interested in

If a man has Type O blood, can his biological children be Type AB? Explain

masha68 [24]

If a man who has Type O blood, his biological children cannot be type AB.

A man who has type O blood cannot father a child with type AB blood, because he did not pass on the type O blood allele to all of his offspring.

5 0

3 years ago

8. You have discovered a novel compound (whoosh), which is an inhibitor of mitochondrial ATP synthesis. You observe that when wh

anyanavicka [17]

Answer:

Answered below

Explanation:

Whoosh is an inhibitor of the f1fo ATP synthase. ATP synthase is an enzyme that catalyses the synthesis of ATP in the mitochondria through the process of oxidative phosphorylation, by using energy from the transmembrane electrochemical proton gradient along the respiratory chain.

ATP synthase is made up of two main subunits called the F0 and F1. These subunits allow for ATP production through their rotational mechanisms.

Various synthetic and natural inhibitors of ATP synthase have been used to study the structure and mechanism of ATP synthase. These inhibitors cause the decrease in the NAD/NADH ratio. They include; polypeptides, organotin compounds, cationic inhibitors, amino acid modifiers, oligomycin and peptide inhibitors.

8 0

3 years ago

After mitosis, how many chromosomes do the new cells have compared to the original?

irakobra [83]

Answer:

The same

Explanation:

In mitosis, genetically identical daughter cells are created. In meiosis the number of chromosomes is half as many as the original cell

6 0

3 years ago

Read 2 more answers

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago

Our sense of position and movement of individual body parts is called

Amiraneli [1.4K]

Position and movment are controlled and uncontrolled by climax or orgasms

4 0

3 years ago

Read 2 more answers