1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lubasha [3.4K]
3 years ago
9

When the single source of pollution can be identified, it is called ______.

Biology
1 answer:
Reika [66]3 years ago
8 0

Answer: <u>Option D point source pollution </u>

Explanation: The pollutants which can be tracked, from the source of origin are termed as point source pollution. This can be water source, air or even light or noise pollution. The pollutants are easily detected being released from the source of pollution. Whereas the non-point source of pollution are those which are indirect sources and they carry off the pollutants which lie on the way, like runoff water carrying the pesticides from the agricultural land. Runoff and waste are examples of non-point sources of pollution. Thus, option A and C are incorrect answers.

You might be interested in
If a man has Type O blood, can his biological children be Type AB? Explain
masha68 [24]

If a man who has Type O blood, his biological children cannot be type AB.

A man who has type O blood cannot father a child with type AB blood, because he did not pass on the type O blood allele to all of his offspring.

5 0
3 years ago
8. You have discovered a novel compound (whoosh), which is an inhibitor of mitochondrial ATP synthesis. You observe that when wh
anyanavicka [17]

Answer:

Answered below

Explanation:

Whoosh is an inhibitor of the f1fo ATP synthase. ATP synthase is an enzyme that catalyses the synthesis of ATP in the mitochondria through the process of oxidative phosphorylation, by using energy from the transmembrane electrochemical proton gradient along the respiratory chain.

ATP synthase is made up of two main subunits called the F0 and F1. These subunits allow for ATP production through their rotational mechanisms.

Various synthetic and natural inhibitors of ATP synthase have been used to study the structure and mechanism of ATP synthase. These inhibitors cause the decrease in the NAD/NADH ratio. They include; polypeptides, organotin compounds, cationic inhibitors, amino acid modifiers, oligomycin and peptide inhibitors.

8 0
3 years ago
After mitosis, how many chromosomes do the new cells have compared to the original?
irakobra [83]

Answer:

The same

Explanation:

In mitosis, genetically identical daughter cells are created. In meiosis the number of chromosomes is half as many as the original cell

6 0
3 years ago
Read 2 more answers
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
Our sense of position and movement of individual body parts is called
Amiraneli [1.4K]
Position and movment are controlled and uncontrolled by climax or orgasms
4 0
3 years ago
Read 2 more answers
Other questions:
  • The fibrous skeleton of the heart functions in all of these ways except in __________.
    13·1 answer
  • In physical science, what does MYA mean when referring to age?
    7·1 answer
  • What two components are often found as part of an enzyme?
    10·2 answers
  • Consider this plant cell.
    11·2 answers
  • What other three things do Volvox also likely lack?
    7·1 answer
  • How does the amount of sunlight that receive affect the height of the plants ?
    12·1 answer
  • What are land slides caused by​
    9·2 answers
  • David is a research scientist who is giving a lecture to a class of students on how life began on Earth. Help him complete the s
    6·2 answers
  • List the types of catastrophic events that are most likely to impact our ecosystem here in Cypress, Texas. (that is where i my s
    8·2 answers
  • Two examples of chemical energy in the process of cellular respiration
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!