First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
to recycle instead of everything going to the trash and also not lotering
The rapid depolarization phase
of myocardial contractile cells is due to the Na+ ions. Sodium ions are essential
for regulation of blood and body fluids, communication of nerve impulses, heart
activity, and metabolic purposes. Physiologically, it survives as an ion in the
body. Sodium is needed by
animals but is not needed by plants. The human prerequisite for sodium<span> must be less
than 500 mg per day. </span>
Answer:
The organism will be recessive tall. Explanation is shown on figure read it.
There are two things that cause ocean water to become denser, and those are b) the salinity of water and low temperatures.
The more salt there is, the denser the water will be - take the lake Dead Sea in Israel, Jordan, and Palestine for example.
And the lower the temperature, again, the denser the water will be - the deeper you go into an ocean, it will be more difficult to move around due to density and other things.
