1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lawyer [7]
3 years ago
8

When a cell undergoes mitosis, what is the result??

Biology
2 answers:
andreyandreev [35.5K]3 years ago
8 0

Answer:

two genetically identical cells

Explanation:

worty [1.4K]3 years ago
7 0
The end result is two identical diploid cells .
You might be interested in
In the carbon cycle, decomposers return carbon to the soil. Which of the following is NOT something that decomposers can break d
erastova [34]

Answer:

<em>b</em><em>.</em><em> </em><em>t</em><em>h</em><em>e</em><em> </em><em>b</em><em>o</em><em>d</em><em>i</em><em>e</em><em>s</em><em> </em><em>o</em><em>f</em><em> </em><em>d</em><em>e</em><em>a</em><em>d</em><em> </em><em>p</em><em>l</em><em>a</em><em>n</em><em>t</em><em>s</em><em> </em><em>a</em><em>n</em><em>d</em><em> </em><em>a</em><em>n</em><em>i</em><em>m</em><em>a</em><em>l</em><em>s</em><em>.</em>

Explanation:

<em>decomposers break down the dead organisms and return the carbon in their bodies to the atmosphere as carbon dioxide by respiration. in some conditions, decomposition is blocked. the plant and animal material may then be available as fossil fuel in the future for combustion.</em>

4 0
3 years ago
Which of the following has a PhD in psychology and specialize in the diagnosis and
trasher [3.6K]

Answer:

Psychiatrist

Explanation:

A psychiatrist is a medical specialist who focuses on mental health issues, such as substance abuse. Psychiatrists are trained to evaluate both the mental and physical components of mental illnesses. I hope this helps and if it does a Brainliest would be nice!

6 0
3 years ago
Seeds- form through ____________ reproduction and contain an embryo that gives rise to a new plant. (Have adaptations that allow
Andrei [34K]

Answer:

Seeds- form through <u><em>sexual </em></u>reproduction and contain an embryo that gives rise to a new plant.

Explanation:

The formation of seeds occur when a ripened ovule is fertilized by pollen. If the pollen and the ovule are from the same plant, then it is termed as self-pollination. If the pollen fertilizes the ovule of another plant then it is known as cross pollination. The seed contains the embryo which has the capability to form and generate into a new plant. Hence, the formation of seeds is a phenomenon which occurs in sexually reproducing plants.

8 0
3 years ago
An experiment is conducted to determine the effects of energy drinks on an individual’s heart rate groups A and B have matched f
Mariulka [41]

Answer:

Explanation: this is complicated

8 0
3 years ago
Theoretical Issue In Development (psychology)
hoa [83]
Just here for the points sorry luv 2A.)true
3 0
4 years ago
Other questions:
  • A student is studying mitosis, in which a cell divides to form two cells. Which of these shows the CORRECT mathematical model fo
    7·2 answers
  • Which is the result of an object's motion?.
    12·1 answer
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • The presence of paired chromosomes makes a diploid/germ/haploid/gamete cell, while a single member of a pair of chromosomes make
    12·1 answer
  • Plzzz helppppppppppppppppppppppppppppppppppppppppppppppppp ive been stuck on this question for days plz plz plz pzl plz zplzplpz
    15·1 answer
  • If a planet has a low density,<br> what can we assume the<br> planet is made of?
    9·1 answer
  • Cells with limited potential to develop into any type of cells are called
    13·1 answer
  • What organelle acts like a whip to move the entire cell
    15·1 answer
  • Is this solution acidic or basic?<br><br> pH=12<br><br><br> basic<br><br> acidic
    10·2 answers
  • What is the surface area of a cell?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!