1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alekssr [168]
3 years ago
12

Do all cells in the population express insulin receptor on their surface? Is this expression dependent on the presence of insuli

n? Explain.
Biology
1 answer:
ad-work [718]3 years ago
7 0
What grade level?? Soo i can try to figure it out
You might be interested in
A pink flower is crossed with a white flower. what is the probability of a pink flower being produced?
qaws [65]

Answer:

The genotype for the pink flower is Rr and the genotype for the white flower is rr. This would lead to a 50% chance of the offspring having a phenotype of pink.

Explanation: Your Welcome !

4 0
3 years ago
Read 2 more answers
Why does an octopus or squid use its tentacles?
spin [16.1K]
Octopus and squid have little suction cups on their tentacles. It helps with sticking onto food (so it doesn't get away) and also helps with sticking into things. If it wanted to camouflage into some rocks, it can use its tentacles to cling to to the rock.

Tentacles can also grab and carry things. Scientists have made tests where they would put a clam in a jar with the lid screwed on. The octopus would grab onto the jar and use its tentacles to twist the lid off.

Without tentacles, octopuses and squids would be pretty helpless and probably couldn't survive in the deep ocean.
8 0
3 years ago
Read 2 more answers
There are places in the world where the forests have been destroyed and trees no longer grow. What needs to take place for a for
Arlecino [84]

Forests are only renewable as long as careful planning is done to determine how many trees to cut and to nake sure new trees are planted to replace them.

5 0
3 years ago
Read 2 more answers
Which ocean zone receives the most amount of sunlight?
Marrrta [24]

the answer is epipelagic zone

7 0
3 years ago
Read 2 more answers
What are the small components (monomers) that make up the large DNA polymer?<br> (15 points)
Natasha2012 [34]
They are called <span>nucleotides. </span>
4 0
3 years ago
Other questions:
  • PLEASE HELP ME !!!! Some organisms have genes that improve their ability to survive and reproduce. If the traits also help their
    14·1 answer
  • Biology answers many questions but it's main focus is?
    5·2 answers
  • HURRY ! 30 pts Where will the image of the paper clip appear to the observer? 1 2 3 4
    5·2 answers
  • 5. The nucleolus is a small, dense object found in the middle of the nucleolus. It makes the RNA and ribosomes for the cell.
    7·1 answer
  • The latest data on adult participation in physical activity reveals that ____________
    11·1 answer
  • Which water based animals have a mechanism to prevent water from diffusing into their bodies
    9·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Phosphorous enters the biotic (living) cycle mostly by (hint: like water) *
    8·1 answer
  • Your Answer
    15·1 answer
  • Why do plants need to obtain carbon atom
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!