Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
because fossil fuels take forever to be created hope this helps
Answer:
Some invent in order to meet basic human needs
Sedimentary rocks are formedwhen sediment is deposited out of air, ice, wind, gravity, or water flows carrying the particles in suspension. This sediment is often formed when weathering and erosion break down a rockinto loose material in a source area.
Wat survey
Hope U had a nice day Nd stay warm