1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vodka [1.7K]
3 years ago
9

How often does necrotizing fasciitis evolve? PLEASE HURRY!

Biology
1 answer:
Akimi4 [234]3 years ago
3 0
Even with treatment, up to 1 in 3 people with necrotizing fasciitis die from the infection. Six out of every 10 people who get both necrotizing fasciitis and streptococcal toxic shock syndrome at the same time die from their infection
You might be interested in
Assembling a complete sequence from fragment sequences
Soloha48 [4]

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

7 0
3 years ago
Which of these best explains why the use of fossil fuels for energy production is a not a long-term solution to the world's ener
QveST [7]

because fossil fuels take forever to be created hope this helps

4 0
2 years ago
Read 2 more answers
1. What term refers to how people change the world around them to meet their needs or solve practical
oksano4ka [1.4K]

Answer:

Some invent in order to meet basic human needs

8 0
2 years ago
Discribe how a sedementary rock such as sandstone is formed
lilavasa [31]
Sedimentary rocks are formedwhen sediment is deposited out of air, ice, wind, gravity, or water flows carrying the particles in suspension. This sediment is often formed when weathering and erosion break down a rockinto loose material in a source area.
4 0
3 years ago
I just started this survey i got to number 5 and i have no idea how to do it.​
Sergeeva-Olga [200]
Wat survey

Hope U had a nice day Nd stay warm
4 0
3 years ago
Read 2 more answers
Other questions:
  • What is the example of hermaphrodite?​
    15·2 answers
  • Which of the following includes only biotic factors?
    5·1 answer
  • Where in a lake is the benthic zone?
    8·2 answers
  • How does organic farming help control hazardous wastes?
    15·1 answer
  • What kind of leaf is this?
    11·1 answer
  • The process helps fuel your metabolism with oxygen.
    9·1 answer
  • ONLY ONE ANSWER!!
    12·2 answers
  • The biological species concept is least relevant to which of the following groups of organisms?
    12·1 answer
  • (GIVING BRAINLIEST!!!!)
    11·1 answer
  • The primary vectors used in gene therapy are:a. fungib. virusesc. bacteriad. mosquitose. prescription drugs
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!