1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kolezko [41]
4 years ago
10

Oil is a fossil fuel that provides power to sustain a modern lifestyle. Which of these statements best describes a benefit of oi

l drilling.
No air pollution is detective from Oil drill machinery

Less expensive source of energy is available

Radiation may cause health problems

Water and soil may be contaminated
Biology
2 answers:
rewona [7]4 years ago
5 0

Less expensive source of energy is available.

hope this helped, please mark brainliest :)

lesya [120]4 years ago
5 0

Answer:

Less expensive source of energy is available

Explanation:

Oil is considered, alongside water, the main natural resource of the modern era. Although there are government efforts around the world to reduce dependence on this element, it is still the most widely used fuel. In addition to the fact that it is a non-renewable resource, oil has the disadvantage of emitting large quantities of pollutants into the atmosphere during its burning.

However, oil has several advantages, the first being that it represents a more efficient and cheaper form of energy. In addition, its reservoirs are generally easy to locate, extract and process.

You might be interested in
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
How is the flow of energy through a community different from the cycling from the matter?.
Paha777 [63]
Matter can be recycled, but energy cannot. Also, only 10% of the energy is passed through each trophic level.
4 0
4 years ago
1. Why do you think temperature is the measure of the "average"
Anit [1.1K]

Answer:

Temperature is the measure of the average energy of motion of all the particles present in a substance because particles of a substance moves due to the presence of kinetic energy.

Explanation:

Kinetic energy is a type of energy that is present in an object due to its motion. When temperature of a substance is increased, the particles absorb heat energy from surrounding environment and starts motion. This motion of particles due to the absorption of heat energy is called kinetic energy. So that's why temperature is considered as a tool to measure average energy of a motion.

8 0
4 years ago
2. A nucleus contains tiny rod-shaped<br> boll bodies. What are they called?
jarptica [38.1K]
A nucleus is something that idek what ur talking abt
5 0
3 years ago
Read 2 more answers
Chloroplast diagram needs labeled<br><br> what are the labels 1-6?
aliina [53]
1- outer membrane 2- inter membrane space
7 0
3 years ago
Read 2 more answers
Other questions:
  • what is the probability that two parents heterozygous for a particular trait will have a child that is homozygous recessive for
    5·1 answer
  • The ability of water to act as a solvent for so many substances is due to its _______.
    9·1 answer
  • There are four standard rifle firing positions. which position provides the least support? prone standing sitting kneeling
    11·1 answer
  • Who were the people left out of the postwar boom? How do you account for their exclusion?
    14·1 answer
  • Which of the following epithelial tissue types is NOT correctly matched to its function?A. stratified squamous epithelium; absor
    12·1 answer
  • Which of the following objects can be seen from earth because they produce their own light ?
    12·1 answer
  • Matter moves in the same direction as wave travels
    12·1 answer
  • 11.
    5·1 answer
  • PLSSS HELP <br> Do you think an international orbiting space station is a good idea? Why or why not?
    5·1 answer
  • Using the ultrasonication and agitation method of liposome preparation, what concentration of lipid is necessary to prepare lipo
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!