Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Matter can be recycled, but energy cannot. Also, only 10% of the energy is passed through each trophic level.
Answer:
Temperature is the measure of the average energy of motion of all the particles present in a substance because particles of a substance moves due to the presence of kinetic energy.
Explanation:
Kinetic energy is a type of energy that is present in an object due to its motion. When temperature of a substance is increased, the particles absorb heat energy from surrounding environment and starts motion. This motion of particles due to the absorption of heat energy is called kinetic energy. So that's why temperature is considered as a tool to measure average energy of a motion.
A nucleus is something that idek what ur talking abt
1- outer membrane 2- inter membrane space