1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Helen [10]
3 years ago
9

Why are chloroplasts found only in plant cells?

Biology
1 answer:
mr_godi [17]3 years ago
8 0
Chloroplasts are only found in plant cells because it is the organelle that makes photosynthesis possible and it makes food for the plant cells as in it makes its own food and animal cells dont need them because animals eat other animals for that food
You might be interested in
Oxytocin and antidiuretic hormone (adh) are synthesized in the ________ but released from the ________.
zvonat [6]
<span>Oxytocin and antidiuretic hormone (adh) are synthesized in the  ypothalamus but released from the posterior pituitary.</span>
8 0
3 years ago
Which of the following is the best example of a positive correlation
Wittaler [7]
It may be determination (not sure though)
8 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
What kind of molecule is formed when many disaccharide molecules are combined?
kondor19780726 [428]
Starch and  Cellulose is formed when many disaccharide molecules are combined
3 0
3 years ago
Read 2 more answers
Renin is made by ________.
Naddika [18.5K]

Answer:

granular cells of the juxtaglomerular apparatus

Explanation:

Renin is a secreted hormone, stored and produced by granular cells. This enzyme is responsible for regulating the water gradient in the human glass and blood pressure. This enzyme helps regulate the extracellular gradient in the blood cell plasma and controls any problems that may appear in the arteries or in all blood vessels in the body.

8 0
3 years ago
Other questions:
  • A student planted two sunflower seeds in pots. There are the same number of water and soil. If she puts one plant on a sunny win
    15·2 answers
  • What organelle breaks down and recycle worn out cells?
    7·1 answer
  • One difference between phtosynthesis and cellular respiration is that cellular respiration occurs
    9·1 answer
  • How do atoms become the complex structures and substances around us
    15·1 answer
  • In humans brown eyes are dominant to blue eyes. A cross between a heterozygous brown-eyed individual and a homozygous blue-eyed
    9·1 answer
  • What type of celestial object is the Sun?
    12·1 answer
  • QUESTION 7
    10·1 answer
  • Please help me name<br>Name 4 organs​
    9·2 answers
  • The benefit of measuring the initial rate of a reaction, Vo, is that early in the course of the conversion of substrate (s) to p
    6·1 answer
  • how does the temperature of water change if you heat it after it has already reached the boiling point?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!