If you need to clarify the directions for a lab activity what should you do

Cecil is sexually attracted to his middle-school English teacher. He doesn’t act on his feelings however, because he realizes th

Alex777 [14]

Answer:

Ego

Explanation:

In 1923, Sigmund Freud's personality theory was structured into three different parts viz: Id, ego and superego

The id is the instinctive and unconscious part of the personality which responds directly to urges, needs and desires. The id operates on the pleasure principle that every wishful impulse should be satiated instantly regardless of the resulting effect.

The ego is the part that mediates between the unreasonable id and societal beliefs. It is the reasoning and decision-making component of the psyche.

The superego is the part that acts as a self critical conscience, reflecting the social standards that has been learnt

In this scenario involving Cecil, the id part of his personality is responsible for the sexual attraction to his English teacher but the ego part of his personality is making him realize that is socially unreasonable for his teacher to respond to his sexual advances. His ego, which operates with the reality principle is restraining him from acting from his feelings in consideration of social realities.

Therefore, his ego is restraining him from expressing his feelings of sexual attraction (Id) considering societal consequences.

4 0

2 years ago

I need to perform RNA transcription and translation on this strand of DNA, given that the mRNA is the opposite of this DNA stran

Anarel [89]

Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.

In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.

So the mRNA strand would be the following :

AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.

So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region

Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.

4 0

3 years ago

Entrainment is the ability to or not to synchronize your breathing to your walking or running step.

wlad13 [49]

True

Entrainment is to synchronize an organism to an external whole for example music or tapping.

Hope this helps!

6 0

3 years ago

Read 2 more answers

100 POINTS IF CORRECT!!!

Yuliya22 [10]

From a Punnett square you can get the genotypic and phenotypic proportions of the progeny produced from a cross. Cross: PpRr x PpRr. F1: PPRR, PPRr, PPRr, PPrr, PpRr, Pprr, ppRR, ppRr, pprr.

<h3>What is a Punnett square?</h3>

The Punnett square is a graphic representation that shows the different types of gamete combinations according to the alleles involved in a cross.

Punnett square shows the probabilities of getting offspring with different genotypes and their consequent phenotypes.

In the exposed example, we know that two genes are involved in the cross.

As we can see, there are dominant and recessive alleles for both genes.

Since each genotype in the square results from the combination of parental gametes, we can figure out which are the parental genotypes.

For instance, let us consider the provided genotypes

PPRr.

We can assume one of the parents provided a P and a R dominant alleles, while the other parent provided another P allele but a r recessive allele.

PR + Pr ⇒ PPRr

ppRr.

One of the parents provided a p recessive allele and a R dominant allele, The other parent provided another p allele and a r recessive allele.

pR + pr ⇒ ppRr

pprr.

Both parents provided p and r recessive alleles.

pr + pr ⇒ pprr

From this information, we can assume parents are heterozygous for both genes.

Cross:

Parentals) PpRr x PpRr

Gametes) PR, Pr, pR, pr PR, Pr, pR, pr

Punnett square) PR Pr pR pr

PR PPRR PPRr PpRR PpRr

Pr PPRr PPrr PpRr Pprr

pR PpRR PpRr ppRR ppRr

pr PpRr Pprr ppRr pprr

F1) 1/16 individuals are expected to be PPRR

2/16 individuals are epected to be PPRr

1/16 individuals are expected to be PPrr

2/16 individuals are expected to be PpRR

4/16 individuals are expected to be PpRr

2/16 individuals are expected to be Pprr

1/16 individuals are expected to be ppRR

2/16 individuals are expected to be ppRr

1/16 individuals are expected to be pprr

For a better understanding, you will find the Punnett square in the attached files representing the parental gametes with different colors, and the resulting genotypes with a combination of these colors.

In this way, you will notice which gamete comes from which parent.

You can learn more about Punnett squares at

brainly.com/question/25357981

#SPJ1

5 0

1 year ago

The circulatory system supports the skeletal muscular system by:

ipn [44]

C) transporting glucose to the cells where it is broken down and energy is released.

5 0

3 years ago

Read 2 more answers