1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vera_Pavlovna [14]
3 years ago
7

Which organism was most hurt by increased storms,and why do you think this is so

Biology
1 answer:
sertanlavr [38]3 years ago
4 0

what are the choices

You might be interested in
A disorder of the hand that creates a flexion deformity of the fingers is called:
SVEN [57.7K]
Dupuytren's contracture
6 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
What is the skeletal system​
Ket [755]

Answer:

The Skeletal System is the system of structures that hold up your body. They keep you standing and hold a majority of your organs.

Explanation:

6 0
3 years ago
Read 2 more answers
What type of survivor ship curve do humans have?
Hatshy [7]
The answer is.....Type I or convex curves are characterized by high age-specific survival probability in early and middle life, followed by a rapid decline in survival in later life. They are typical of species that produce few offspring but care for them well, including humans and many other large mammals.
7 0
3 years ago
How does meiosis differ from mitosis?
BlackZzzverrR [31]

Answer:

It reduces the amount of DNA

Explanation:

Ends up with four daughter cells that each have half the amount of chromosomes in the parent cell.

8 0
3 years ago
Other questions:
  • Plants have structural organization. Which structures are classified as plant organs?
    8·1 answer
  • NEED HELP ASAP * I THINK IS MY ANSWER
    10·1 answer
  • I am doing Mediterrean Biome. Do anyone know any of these?
    5·1 answer
  • Two of the main ingredients in plant fertilizer are phosphorus and nitrogen. These elements are required for the synthesis of __
    11·1 answer
  • List all the organ systems
    14·1 answer
  • What could we do to destroy dangerous
    12·1 answer
  • Can humans be cold-blooded?
    7·1 answer
  • What materials are transported in a plant
    14·1 answer
  • Which of these is a primary reason that good air quality should be maintained?
    10·1 answer
  • Assume population b and population c evolve until they reach adaptive peaks and experience stabilizing selection. Both populatio
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!