1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ryzh [129]
3 years ago
14

Cell Structure and Function

Biology
1 answer:
Licemer1 [7]3 years ago
7 0
The physical shape of the cell structure is shootist octahedral to Aline the alignment of the mitochondria powerhouse
You might be interested in
Mary decided she wanted to experiment with the color of her white roses. She placed
Rudik [331]

Answer:

A : cohesion and adhesion

Explanation:

3 0
3 years ago
Changing states of water requires energy, where does that energy come from?
I am Lyosha [343]

Answer:

Energy comes from different sources such as oil, coal the wind and the sun.

3 0
3 years ago
Read 2 more answers
Allergic responses to inhaled antigens occur when an individual is first sensitized to the antigen (i.e., the allergen), inducin
Phoenix [80]

Allergic responses to inhaled antigens occur when an individual is first sensitized to the antigen (i.e., the allergen), inducing an immune response and then has a subsequent exposure to the same antigen. The sensitization phase is characterized by <u>Induction of a CD4 T cell type II immune response</u>.

The process by which your body becomes sensitive to a particular substance is called sensitization. When your immune system becomes sensitized to an allergen, you can develop certain symptoms.

Antigens that can induce an allergic response are called allergens, and they are often derived from non-infectious or non-microbial sources.

To learn more about allergy and sensitization, here

brainly.com/question/8698396

#SPJ4

5 0
2 years ago
How long would it take to walk 700 miles?
zaharov [31]
It would takes around 175 hours to walk 700 miles.
4 0
3 years ago
Stars release lots of energy in the form of what kind (or kinds) of light?
Luden [163]
C is the answer :))))))))))))))))))))))))))))))
7 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following blood types is considered a "universal receiver"? A B AB O
    10·2 answers
  • Rising sea levels are a possible global consequence to a change in local environments. Please select the best answer from the ch
    12·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • What are the 5 characteristics of a mineral?
    15·1 answer
  • Ejemolos de sustentabilidad ​
    5·1 answer
  • How many different species are there?kings and kigdoms
    15·1 answer
  • Correlate crossing-over with genetic linkage
    12·1 answer
  • Dandelions can produce seeds by both asexual and sexual
    6·1 answer
  • Pls help me its only 5 questions
    6·1 answer
  • A mutation occurred in a population of wombo birds. Birds with the mutation are able to eat mangoes but those without the mutati
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!