Answer:Each and every one of us have several roles. Organisms in a community play other roles too. An organism's role within an ecosystem depends on how it earn its nutrients. Organisms collect their nutrients in very different actions, so they have different roles in an ecosystem.
Explanation:
The food chain describes who eats whom in the wild. Every living thing—from one-celled algae to giant blue whales—needs food to survive. Each food chain is a possible pathway that energy and nutrients can follow through the ecosystem.
For example, grass produces its own food from sunlight. A rabbit eats the grass. A fox eats the rabbit. When the fox dies, bacteria break down its body, returning it to the soil where it provides nutrients for plants like grass.
Of course, many different animals eat grass, and rabbits can eat other plants besides grass. Foxes, in turn, can eat many types of animals and plants. Each of these living things can be a part of multiple food chains. All of the interconnected and overlapping food chains in an ecosystem make up a food web.
Histone deacetylase is responsible for removing the acetyl group from the histone 3 lysine 9 residue. Remember that deacetylation is one step in converting euchromatin to heterochromatin. Because euchromatin is transcriptionally active (transcriptional machinery is able to reach gene of interest), and blocking histone deacetylase activity would result in an the DNA remaining as euchromatin, we would expect to see an increase in transcriptional activity.
So there’s your answer: An increase in transcriptional activity.
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
Answer: Negative
When converting from scientific notation to standard notation if the power of 10 is negative we move the decimal to the left. If it is positive we move the decimal to the right.
Example: 3*10^-3=.03 and 3*10^3=300