1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
katrin [286]
3 years ago
10

Carbon dioxide can be produced from what type of power generation?

Biology
2 answers:
andrew11 [14]3 years ago
6 0

Coal is the correct answer.

As we know all the fossil fuels upon burning produce carbon dioxide but coal produces largest carbon dioxide emissions in the world. The coal is the largest source of power generation in the world and thus the major cause of air pollution.

All the other given options here do not produce carbon dioxide and are environment friendly sources of energy.

DedPeter [7]3 years ago
4 0
Coal. -from my dad lol ill check
You might be interested in
A table with four organisms and their primary role in an ecosystem is shown.
Otrada [13]

Answer:Each and every one of us have several roles. Organisms in a community play other roles too. An organism's role within an ecosystem depends on how it earn its nutrients. Organisms collect their nutrients in very different actions, so they have different roles in an ecosystem.

Explanation:  

The food chain describes who eats whom in the wild. Every living thing—from one-celled algae to giant blue whales—needs food to survive. Each food chain is a possible pathway that energy and nutrients can follow through the ecosystem.

For example, grass produces its own food from sunlight. A rabbit eats the grass. A fox eats the rabbit. When the fox dies, bacteria break down its body, returning it to the soil where it provides nutrients for plants like grass.

Of course, many different animals eat grass, and rabbits can eat other plants besides grass. Foxes, in turn, can eat many types of animals and plants. Each of these living things can be a part of multiple food chains. All of the interconnected and overlapping food chains in an ecosystem make up a food web.

3 0
3 years ago
If you block histone deacetylase, what effect would you expect to see on transcriptional activity?.
Shalnov [3]
Histone deacetylase is responsible for removing the acetyl group from the histone 3 lysine 9 residue. Remember that deacetylation is one step in converting euchromatin to heterochromatin. Because euchromatin is transcriptionally active (transcriptional machinery is able to reach gene of interest), and blocking histone deacetylase activity would result in an the DNA remaining as euchromatin, we would expect to see an increase in transcriptional activity.

So there’s your answer: An increase in transcriptional activity.
8 0
2 years ago
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
Many important fossil discoveries have occurred in the Great Rift Valley of Africa. Describe the process that enabled these foss
Sonja [21]
B is the correct answer
3 0
3 years ago
Need help soon as possible
Sonbull [250]

Answer: Negative

When converting from scientific notation to standard notation if the power of 10 is negative we move the decimal to the left. If it is positive we move the decimal to the right.

Example: 3*10^-3=.03 and 3*10^3=300

7 0
3 years ago
Read 2 more answers
Other questions:
  • Why is the ulna less movable than the radius?
    6·1 answer
  • amie is performing an experiment that involves chemicals, test tubes, and burners as part of her biotechnology workshop. Which o
    11·1 answer
  • Scientists are constantly learning more and more about fossils because
    8·2 answers
  • Rising sea levels would affect more than coastlines. What factor might increase enough in freshwater wetlands to affect plant an
    6·2 answers
  • What occurs when one cannot move certain parts of the body
    12·2 answers
  • Which option identifies ways that people positively affect Earth's resources?
    14·2 answers
  • What the answer to this question?
    7·1 answer
  • The presence of a beard on some goats is determined by an autosomal gene that is dominant in males and recessive in females. Het
    13·1 answer
  • Explain the interdependence of photosynthesis and cellular respiration. Discuss the effect on organisms that perform cellular re
    5·2 answers
  • What is a group of similar cells that perform the same function?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!