1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tanzania [10]
3 years ago
13

Roundworms have _____ muscle that helps them move.

Biology
2 answers:
dezoksy [38]3 years ago
6 0
Roundworms have longitudinal muscles that helps them move.
Longitudinal muscles is the same as the human esophagus, meaning it can be stretch and bend that's why roundworm can move circular or any position they want
Andrews [41]3 years ago
6 0

Roundworms have longitudinal muscles that helps them move. Longitudinal muscles is the same as the human esophagus, meaning it can be stretch and bend that's why roundworm can move circular or any position they want.

You might be interested in
Which component of the Earth's atmosphere is decreased due to photosynthesis
Marianna [84]
Decrease carbon dioxide
6 0
3 years ago
Starting from the sun, create a food chain including at least three organisms. Explain how energy is transferred through the cha
Kryger [21]

Answer:

The food chain showing seven organisms can be drawn as follows:

Plants → grasshoppers → mice → frog → snakes→ eagles → decomposers

The plants are the primary source of food in a food chain or a food web. The animals which feed on plants will be termed as herbivores or primary consumers like the grasshopper. The organisms feeding on primary consumers will be the secondary consumers like mice.

An energy pyramid for three of the organisms can be shown as follows:

              mice (10 kilocalories)

                   ↑

        Grasshoppers (100 kilocalories)

                   ↑

       Plants ( 1000 kilocalories)

As the energy pyramid shows, only about 10% of the energy travels from one trophic level to another.

Explanation:

6 0
2 years ago
Where are stem cells found in animals
Genrish500 [490]

In the lower layers of the skin and small intestines

May Nilbin Be With You

8 0
3 years ago
Read 2 more answers
Please I need help with question 63 which is after the ice cubes have melted completely, which glass will contain a mixture and
larisa86 [58]
The cup with the Alcohol inside 
8 0
3 years ago
Given the sequence ATGGCGAATCACGTCACTTGA
Marina86 [1]

Answer:

a. TACG

b.UAC CGC UUA GUG CAG UGA ACU

c.ATCG

d.ser-arg-leu-val-ser-stop-thr

Explanation:

4 0
3 years ago
Other questions:
  • What are the three types of homologies and the definitions?
    6·1 answer
  • Plants and animals are composed of organic compounds what are they
    10·1 answer
  • Some mutations always occur from generation to generation but most mutations to not persisting overtime in the gene pool which m
    14·1 answer
  • The cell theory was constructed by _____. Robert Hook Schleiden and Schwann Carolus Linnaeus
    10·2 answers
  • Systematists have used a wide variety of traits to reconstruct the phylogenies of particular groups of organisms. Which one of t
    10·1 answer
  • Kyoto protocol -<br><br> How did it come about ?<br> Why are people arguing about it ?
    5·2 answers
  • The portion of the stomach closest to the duodenum is called the ________.
    8·1 answer
  • What is the role of shell-building marine creatures in regulating climate?
    15·2 answers
  • A. Draw a food chain that could exist in your ecosystem.
    13·1 answer
  • Where dose mass of a willow tree come from
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!