1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
makvit [3.9K]
3 years ago
5

Is an atom matter? Explain

Biology
1 answer:
Korvikt [17]3 years ago
3 0

Answer:

It´s a particle of matter. So, yeah kinda lol

Explanation:

atom, smallest unit into which matter can be divided without the release of electrically charged particles. It also is the smallest unit of matter that has the characteristic properties of a chemical element. As such, the atom is the basic building block of chemistry.

An atom is a particle of matter that uniquely defines achemical element. An atom consists of a central nucleus that is usually surrounded by one or more electrons.

You might be interested in
What is the best way for women to Masterbate? It's for my anatomy class...please it’s due in an hour!!!
fredd [130]

are you being for real?

3 0
3 years ago
Read 2 more answers
HELP PLEASE WILL GIVE BRAINLY! <br><br> What is a complementary RNA strand to AGA?
Irina18 [472]

Answer:Problem Set 4 Answers

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

b. False, a frameshift mutation affects all the subsequent amino acids.

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

d. False, the wobble is first base (5’ to 3’) in the anticodon.

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), then the Np and N-OH fragments should be labeled with tritium.

d. Since the N-OH fragments were labeled with tritium, RNA synthesis must occur in a 5' to 3' direction.

6. In a missense mutation, the new nucleotide alters the codon so as to produce an altered amino acid in the protein product.  With a nonsense mutation, the new nucleotide changes a codon that specified an amino acid to one of the stop codons (TAA, TAG, or TGA). Therefore, translation of the messenger RNA transcribed from this mutant gene will stop prematurely.

Explanation:

5 0
3 years ago
When one DNA molecule is copied to make two DNA molecules, the new DNA
jarptica [38.1K]
That would be B.

One strand will be newly made the other will be old/parent strand.
6 0
4 years ago
Read 2 more answers
Please help mee
saveliy_v [14]

Answer:

The study of mathematics as a "demonstrative discipline" begins in the 6th century BC with the Pythagoreans, who coined the term "mathematics" from the ancient Greek μάθημα (mathema), meaning "subject of instruction".[4] Greek mathematics greatly refined the methods (especially through the introduction of deductive reasoning and mathematical rigor in proofs) and expanded the subject matter of mathematics.[5] Although they made virtually no contributions to theoretical mathematics, the ancient Romans used applied mathematics in surveying, structural engineering, mechanical engineering, bookkeeping, creation of lunar and solar calendars, and even arts and crafts.

Explanation:

3 0
3 years ago
Expiratory reserve volume (ERV) You ask your lab partner to inspire a normal tidal inspiration, and breathe out a normal tidal e
Bumek [7]

The average expiratory reserve volume or ERV is 810.

<h3>What is expiratory reserve volume?</h3>
  • Expiratory reserve volume or ERV is the amount of air that is exhaled forcibly.
  • This can be measured using a spirometer and is used to detect restrictive lung diseases.
  • It is the maximum amount of air that can be exhaled after normal tidal volume is exhaled.
  • Respiratory volume is the volume of air which is either inhaled, exhaled or stored in your lungs.
  • The doctors estimate the reserve volume with the help of spirometer to determine some lung diseases.
  • Once diagnosed with a lung disease, spirometry is used to monitor it.
  • Here, 3 readings of ERV are taken, calculate the sum of the these and divide by 3 to calculate the average ERV.
  • ERV= (800+ 850+ 780)/ 3= 810

Learn about tidal volume here:

brainly.com/question/13077530

#SPJ1

7 0
2 years ago
Other questions:
  • Maria bought a 1.75-pound package of turkey at a cost of $3.90 per pound. How much did Maria spend?
    7·1 answer
  • How is a tissue different from an organ? How are they similar?
    10·1 answer
  • Processes that determine heredity and contribute to genetic variationMeiosis guarantees that in a sexual life cycle, offspring w
    14·1 answer
  • On early Earth, what was referred to as the "primordial soup"?
    8·1 answer
  • The condition in which a person's body relies on a given drug in order to function isthe condition in which a person's body reli
    11·2 answers
  • Nancy is about to give a presentation to her school’s advisory board about some upcoming changes to their Nursing program. She w
    9·2 answers
  • Helppppppp please kshshshshshsh with science i dislike it smmmmmm​
    10·2 answers
  • What are the processes in cellular respiration? ( middle school level)
    8·2 answers
  • The structurelabeled two represents in molecule of ?
    9·1 answer
  • Which endocrine organ is responsible for the production of adh oxytocin and regulatory hormones?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!