1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexgriva [62]
3 years ago
6

Which enzyme is responsible for creating the covalent bonds that connect the sugar phosphate backbone of the new. DNA molecule?

Biology
2 answers:
Sati [7]3 years ago
7 0
The ligase should be the answer you are looking for
Oksi-84 [34.3K]3 years ago
3 0
Ligase is the answer 
You might be interested in
Which of the following correctly describes the importance of the nitrogen cycle?
victus00 [196]
The answer is C. To decompose death animals.

<em /><em>That's a very important thing to be done in life. Can you imagine it, all animals death without being decomposed, left there for like years and years... That would be so smelly! 
</em>
I hope this helped you! Good luck!!

<em>~Thanks~!! <3</em>
4 0
3 years ago
Read 2 more answers
Where do scientists find most deep-ocean trenches?
Rudiy27
Scientists find most deep-ocean trenches in the Pacific. Example being the Mariana Trench.
5 0
3 years ago
Read 2 more answers
PLEASE HELP (50 POINTS)
baherus [9]

Athletics would be the easiest choice here

Sports are an active that takes up a lot of different organ systems. When running I use my muscular system and cardiovascular system the most. The cardiovascular system directly controls running because it helps prevent me from getting tired and worn out faster.

Hope this helps :)

7 0
2 years ago
How many grams are in 2 moles of argon?
FrozenT [24]
The SI base unit for amount of substance is the mole. 1 mole is equal to 1 moles Argon, or 39.948 grams.
7 0
3 years ago
The diagnostic test for HIV, the virus that causes AIDS, involves testing the blood for antibodies with this pathogen. Antibodie
Elden [556K]

Answer:

Detects foreign antigens

Explanation:

Antibodies are the defense cells of the body. They are produced by the white blood cells and help in fighting and killing foreign bodies which are known as antigens. The antibodies attacks the antigens by binding onto it and releasing chemicals to kill it or by engulfing the foreign body( antigen).Examples of antibodies are IgA and IgG.

8 0
3 years ago
Other questions:
  • A germ cell of an organism has 60 chromosomes in it. It undergoes meiosis, and at the end it produces four daughter cells. What
    6·2 answers
  • Compared to nonpoint source pollution, point source pollution___
    8·1 answer
  • Which statement about the changes in the history of life on Earth is correct? A. The theory of plate tectonics explains why the
    6·1 answer
  • If a patient receives a _____________ from a healthcare organization it indicated that the patient's protected health informatio
    12·1 answer
  • 3. Paul's travels between the United States and Africa have been shocking because of the unexpected contrasts and similarities b
    13·1 answer
  • Language functions of the brain are controlled by which side of the brain
    10·2 answers
  • A particular plant has 10 pairs of chromosomes in each cell. For each of the plant's gametes, how many genetic combinations are
    6·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Because flamingos spend most of their time in water, heat is easily lost through their legs and feet. Scientific studies have su
    13·2 answers
  • 2.The blood-sucking parasites which attack the outside of the host are called __.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!