1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sattari [20]
3 years ago
12

How does carbon dioxide enter the atmoshpere

Biology
1 answer:
klemol [59]3 years ago
8 0

When we inhale, we take in oxygen, and give out carbon dioxide when we exhale. The carbon dioxide we breathe out/exhales enters the atmosphere.

You might be interested in
When a chromosomes undergoes a deletion mutation, information is ?
Readme [11.4K]
Well,

By the word "deletion" we can deduce that information is lost.  Therefore, when a chromosome undergoes a deletion mutation, information is lost.  This can have disastrous effects if it is a human chromosome.
7 0
4 years ago
What made Brazil's fight for independence unique and different from other Latin American rem
Elenna [48]

Answer:

The Brazilian independence movement was achieved with almost no resistance from Portugal as the Portuguese king, Dom Pedro I had been told by his father that if independence must come to Brazil he should let it. So in essence, it was the only Latin American nation to achieve independence without bloodshed or conflict.

hopes this helps:) :D :)

Explanation:

6 0
3 years ago
Read 2 more answers
Which statement best explains how respiration and photosynthesis are related to one another?
PIT_PIT [208]

Answer: D

Explanation:

photosynthesis - takes in water, energy from the sun, and carbon dioxide and releases oxygen and glucose (sugar)

respiration - takes in glucose and oxygen, and releases water and carbon dioxide and energy

they are basically the opposite

HAVE A GREAT DAY :)

6 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Name the main organ that damage in the developing embryo, if the mother consumes alcohol during pregnancy .
abruzzese [7]

Answer:

Placenta

Explanation:

Any amount of alcohol can harm a developing fetus and increase the risk of miscarriage. Alcohol easily passes through the placenta, the organ that nourishes a baby during pregnancy

4 0
3 years ago
Other questions:
  • Which statement best describes the difference between a physical change and a chemical change
    15·2 answers
  • Cells use passive and active transport to move materials across cell membranes in order to maintain a constant internal environm
    6·1 answer
  • Why is DNA critical to cell differentiation?
    5·1 answer
  • Dna and rna both have sugars as their structural base, what are the names of these bases in both dna and rna?
    14·1 answer
  • Leann is learning about chemical reactions. She wants to create a model of a chemical reaction, so she is examming the informati
    6·1 answer
  • What characteristics describes an old river​
    9·1 answer
  • Which statement correctly compares the roles of different types of organic molecules in the body?
    5·1 answer
  • What is the speed of grid method in forensics
    14·1 answer
  • 2. What will happen to an animal cell placed in a 85% salt water solution?
    9·1 answer
  • You have rock A with a volume of 15cm3 and a mass of 45 g. You have rock B with a volume of 30cm3 and a mass of 60g.
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!