1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rom4ik [11]
3 years ago
6

Brainliest + 50 points! Its ya lucky day :D

Biology
2 answers:
stepladder [879]3 years ago
7 0

I think the hormone would be testosterone, it would be subjectively deemed useless in times other than procreation. I would suggest that the important hormone is the growth hormone Thank you for your question.

Anvisha [2.4K]3 years ago
7 0

hmmm

Follicle stimulating hormone

This hormone helps to regulate growth spurts, puberty hormone factors and assists in developing further for reproduction

I would rather not have this because hormones are really annoying as they mess up your head and they bug you. It is really necessary though but right now I'd rather not have it

You might be interested in
The positively charged particle in an atom's nucleus is called the ______
Anika [276]
Protons! Hope this helps
7 0
3 years ago
Which of the following is NOT a type of neuron?
xxTIMURxx [149]
I believe its D. response neuron.

Hope this helps!

Love, Grace-
8 0
3 years ago
Read 2 more answers
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
If the amino acin the protiens of 2 organisms are similar, why will their DNA also be similar?
ladessa [460]
If I’m not incorrect, DNA is made from amino acids
6 0
3 years ago
All of the following are examples of properties of water except a.bouyancy b.respidity c.salinitay d.alkalinity
brilliants [131]
All of the following are examples of properties of water except bouyancy
7 0
3 years ago
Other questions:
  • The term osteoid refers to the organic part of the matrix of compact bones. the term osteoid refers to the organic part of the m
    15·1 answer
  • Evidence used to support spontaneous generation was the observation that foods over time become covered in maggots or fungal and
    6·1 answer
  • BRAINLIESTTT ASAP!!!
    15·2 answers
  • ____FeSO4 + ____CuCl --------&gt; ____Cu2SO4 + ____FeCl2
    9·1 answer
  • I NEED AN HONEST ANSWER, PLS HELP!
    9·2 answers
  • Some engineers are creating models of several unicellular organisms. What would all the models have in common?
    15·1 answer
  • The diagram shows a bacterium. Which labels best complete the diagram
    15·1 answer
  • Explain the variation of the basal metabolic rate with; i) sex ii) age​
    5·1 answer
  • What causes large amounts of air to move?
    10·1 answer
  • Lakes rivers and streams are included in what type of water
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!