When we burn fossil fuels to produce electricity, heat, and more, they emit greenhouse gases (GHGs) like carbon dioxide (CO2) and methane. These gases trap the sun’s energy in Earth’s atmosphere as heat. As more and more GHGs are released, more heat gets trapped and the planet warms up, disrupting the long-standing, delicate climate systems that have made life on Earth possible.
The stronger storms and longer droughts we see becoming a dangerous new normal are a direct result. But how these impacts play off each other is far more nuanced. In many cases, the wildfires or disappearing glaciers we see in the headlines have unseen knock-on effects that lead to, well, more wildfires and disappearing glaciers.
Think of it like dominos lined up in an infinite spiral – once one domino falls, it creates a reaction that pushes over another and then another right on down the line.
Answer: Different genes being expressed.
Explanation:
The differences in the structure of the muscle and the nerve cells is due to the gene expression or gene expressed in the cell and the gene silenced to achieve the desired organisation of cells.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer:
Explanation:
I'll give you a few things to do overall, but the other one who answered my question has all the good points. Your portfolio must include :-
Cover Page Table of contents
Topic of discussion and brief explanation
Charts, pictures or any art works relevant to the topic
Survey, Project or Case study
Brief conclusion
Reference {Websites from which you reffered }
Hope it helps! Thank you!!!
