1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aleonysh [2.5K]
3 years ago
7

Which of the examples shows a response to a stimulus?

Biology
1 answer:
marishachu [46]3 years ago
4 0

Answer:

D

Explanation:

because it shows the features of a bird

You might be interested in
Drawings of prophase, prophase 1, metaphase, anaphase, and telophase,
Artyom0805 [142]
Check for a diagram on google images :) they have a lot that you can just trace
6 0
3 years ago
What must people share to be considered a social group?
masha68 [24]
Characteristics shared by members of a group may include interests, values, representations, ethnic or social background, and kinship ties. (Sorry this is late) just saw this now.
3 0
3 years ago
Explain what it is called when two prides of lions compete for prey versus if leopards compete with a pride of lions for prey.
tatiyna

Answer:

Play in pride

Explanation:

8 1
3 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
Whats the oceans climate
igor_vitrenko [27]
An oceanic climate<span> (also known as marine, west coast and maritime) is the </span>climate<span> typical of west coasts in higher middle latitudes of continents, and generally features cool summers and cool (but not cold) winters, with a relatively narrow annual </span>temperature<span> range and few extremes of </span>temperature<span>.

</span>
8 0
3 years ago
Other questions:
  • Which of the following is principally responsible for water cycling in plants?
    12·2 answers
  • Where does the glucose that is released into the blood ultimately end up (2 places)?
    6·1 answer
  • Why is the use of stem cells so controversial?
    5·1 answer
  • Which list below describes the next steps of evaporated water through the water cycle?
    8·2 answers
  • A science class is planning an investigation about gravity and objects on Earth. In three to four sentences, explain the steps t
    11·1 answer
  • And humans a cleft chin is stopping it and no left is recessive What will generations look like assume that men do its method of
    15·1 answer
  • Give an example of a dry climate.
    11·1 answer
  • Inside cells, special molecules carry messages from the membrane to the nucleus. Which body system uses a similar process?
    10·2 answers
  • Which of the following is NOT a resource that organisms fight over for survival?
    15·2 answers
  • Red hair is recessive trait, non red is dominant character. At which marriages we can expect 100% probability of red-haired chil
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!