All categories

2 years ago

Which one is it I am confused A,B,C or D

Biology

2 answers:

dmitriy555 [2]2 years ago

4 0

Answer:

I think option B is right answer

Andrew [12]2 years ago

3 0

Answer:

B) Image 1 -> Image 3 -> Image 4 -> Image 2

Explanation:

The pictures of the ecosystems are needed to be put into the simplest -> complex order.

Image 1 could be the simplest as it only has one organism.

Image 3 would be the next simplest as it has only a group of the same organism.

Image 4 would come next as it has aqua life and surroundings but the same fishes!

Image 2 would be the most complex, as it has various biodiversity and surroundings!

The order would go as Image 1 -> Image 3 -> Image 4 -> Image 2.

You might be interested in

What does occean salinaty refer to

alukav5142 [94]

Answer:

sea

Explanation:

≈≈≈≈≈≈≈≈

6 0

3 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

How does the human body defend itself--from the time a virus invades the body until it is wiped out?

labwork [276]

I think its the immune system <span>¯\_(ツ)_/¯</span>

4 0

3 years ago

How do bacteria regulate transcription of these operons?

Semmy [17]

Kindly see answers below:

1. operon is not transcribe• b.) lac operon: lactose absent• e.) trp operon: tryptophan present2. operon is transcribed, but not sped up by the positive control• a.) trp operon: tryphophan absent• d.) lac operon: lactose present, glucose present3. operon is transcribed quicklu through positive control• c.) lac operon: lactose present, glocuse absent

7 0

3 years ago

Photosynthesis and Cellular Respiration

Nat2105 [25]

Answer:

Explanation:think about it

7 0

3 years ago