1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mylen [45]
3 years ago
9

Which of the following best supports the endosymbiont theory that present-day eukaryotic cells are descendants of a successful s

ymbiotic relationship between a host cell and an engulfed prokaryote?
Chloroplasts and mitochondria replicate in a similar manner as some prokaryotes.
Chloroplasts are necessary for photosynthesis reactions in plant and bacteria cells.
Mitochondria and chloroplasts are able to produce ATP molecules to be used by the cell.
Mitochondria use proteins and nutrients produced in other regions of the eukaryotic cell.
Biology
2 answers:
harina [27]3 years ago
8 0

Answer:

The correct answer is option - 1. Chloroplasts and mitochondria replicate in a similar manner as some prokaryotes.

Explanation:

The endosymbiotic theory says that two eukaryotic cell organelles mitochondria and chloroplast have some prokaryotic especially bacteria-like characteristics and it also said that they are evolved from the symbiotic bacteria, mitochondria from alpha proteobacteria and chloroplast from cyanobacteria.

Thus, the correct answer is option A. Chloroplasts and mitochondria replicate in a similar manner as some prokaryotes.

padilas [110]3 years ago
6 0

The final answer is A :)

<3

You might be interested in
What are three kinds of volcanoes? What makes them different?
sashaice [31]

Answer:

Composite, shield, cinder cones, and supervolcanoes are the main types of volcanoes.

Composite volcanoes are tall, steep cones that produce explosive eruptions.

Shield volcanoes form very large, gently sloped mounds from effusive eruptions.

Volcanoes have several shapes, which are controlled by the composition of the magma and the nature of its eruption. If a volcano produces very fluid lava (low in the compound SiO2, or silica), the magma flows a long distance before it cools, making a flat, shield-shaped volcano.

Explanation:

6 0
3 years ago
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
What is the control group in an experiment?
jeka57 [31]
The control group outs the one that you don't change. The reason you don't change it is because you use it as a comparison with the other groups.
4 0
3 years ago
Read 2 more answers
Life comes from the <br><br> -Water<br> -Land<br><br> WHICH PLEASE HELP?
Galina-37 [17]
Land it comes from the land
6 0
3 years ago
Read 2 more answers
50 POINTS AND BRANIEST!!! PLS HELP!
Scorpion4ik [409]

transgenic organism has a specific desirable gene transplanted to another organism. so the first step is to identify the desirable gene. ans is D. Find a gene in one species that would be useful if added to the DNA of another species.

8 0
4 years ago
Read 2 more answers
Other questions:
  • Insertion into the RER membrane is cotranslational for TMPs, why is this necessary?
    13·1 answer
  • Which of the following is NOT true?
    6·1 answer
  • What is the difference between a cyclone and an anticyclone? *
    14·1 answer
  • The parents of a 2-year-old arrive at a hospital to visit their child. The childis in the playroom when the parents arrive. When
    6·1 answer
  • The first organisms on Earth were most likely today's:
    12·1 answer
  • A group of organisms that are all the same species is call a(n)
    5·2 answers
  • How can individuals protect, prevent, or treat diabetes?
    10·1 answer
  • Helpppp meeeeeee..............................
    7·1 answer
  • Here is a country test!
    5·1 answer
  • Which body system is responsible for producing the hormone adrenaline?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!