1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tju [1.3M]
3 years ago
12

What number is not part of the domain of the function: g(x)=x+2/x-1 ? how can you tell?

Mathematics
1 answer:
Charra [1.4K]3 years ago
3 0

Answer:

x = 1 is not part of the domain

Step-by-step explanation:

The denominator of g(x) cannot be zero as this would make g(x) undefined. Equating the denominator to zero and solving gives the value that x cannot be.

solve

x - 1 = 0 ⇒ x = 1 ← restricted value

You might be interested in
5x+2y=9, and 5x+10y=75,
MatroZZZ [7]

Answer:

x = -1.5 y = 8.25

Step-by-step explanation:

5x + 2y - 5x - 10y = -66

8y = 66

y = 8.25

5x + 2(8.25) = 9

x = -1.5

3 0
2 years ago
How are two figures congruent?
Sedbober [7]

When angles and sides are all equal

3 0
3 years ago
Find the z score that has 70.54% of the distribution area to its right
Alik [6]

The z score that has 70.54% of the distribution area is 9.92

<h3>What is a z-score?</h3>

The z-score is a numerical measurement used in statistics to refer to how much a given value differs from the standard deviation.

For the random variable x, the z-score is;

z = (x - 11)/2

therefore, 70.54% of the area under the curve lies to the right of x,

then the area to the left of x is;

100 - 70.54 = 29.46%

From the standard table, a z-score of -0.54 will yield an area of 29.46% to the left of x.

Therefore, we get;

(x - 11)/2 = -0.54

x - 11 = -0.54(2)

x = 9.92

The z score  is 9.92

Learn more about z score here;

brainly.com/question/4167122

#SPJ1

7 0
1 year ago
How do you find the answer
KengaRu [80]
You need to measure the angles wich means that u use a protractor if the angle is 90 degrees is a straight angle if it is below 90 degrees is acute and if it is above 90 degrees it's obtuse

6 0
3 years ago
A helicopter is flying above a town. the local high school is directly to the east of the helicopter at a 20° angle of depressio
guapka [62]
Answer: 4.5 miles

Explanation:

When you draw the situation you find two triangles.

1) Triangle to the east of the helicopter

a) elevation angle from the high school to the helicopter = depression angle from the helicopter to the high school = 20°

b) hypotensue = distance between the high school and the helicopter

c) opposite-leg to angle 20° = heigth of the helicopter

d) adyacent leg to the angle 20° = horizontal distance between the high school and the helicopter = x

2) triangle to the west of the helicopter

a) elevation angle from elementary school to the helicopter = depression angle from helicopter to the elementary school = 62°

b)  distance between the helicopter and the elementary school = hypotenuse

c) opposite-leg to angle 62° = height of the helicopter

d) adyacent-leg to angle 62° = horizontal distance between the elementary school and the helicopter = 5 - x

3) tangent ratios

a) triangle with the helicpoter and the high school

tan 20° = Height / x ⇒ height = x tan 20°

b) triangle with the helicopter and the elementary school

tan 62° = Height / (5 - x) ⇒ height = (5 - x) tan 62°

c) equal the height from both triangles:

x tan 20° = (5 - x) tan 62°

x tan 20° = 5 tan 62° - x tan 62°

x tan 20° + x tan 62° = 5 tan 62°

x  (tan 20° + tan 62°) = 5 tan 62°

⇒ x = 5 tant 62° / ( tan 20° + tan 62°)

⇒ x = 4,19 miles

=> height = x tan 20° = 4,19 tan 20° = 1,525 miles

4) Calculate the hypotenuse of this triangle:

hipotenuese ² = x² + height ² = (4.19)² + (1.525)² = 19.88 miles²

hipotenuse = 4.46 miles

Rounded to the nearest tenth = 4.5 miles

That is the distance between the helicopter and the high school.
5 0
3 years ago
Read 2 more answers
Other questions:
  • Which fraction is equivalent to 48%?
    7·2 answers
  • As the owner of a small restaurant, you purchase 5 boxes of napkins for $75.00 every 3 months. Each box contains 525
    10·1 answer
  • 29 is what percent of 185? round your answer to the nearest hundredth.
    7·1 answer
  • Find the quadratic polynomial whose graph goes through the points (-1,8), (0,6), and (2, 26). f(0) = x^2+ x+
    9·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • What is a good website to get answer to a CA on a computer
    11·1 answer
  • 9/115 simplified??????
    10·1 answer
  • Brainly told me to type 20 characters.
    8·2 answers
  • A family is driving 1,036 miles to visit the Blue Ridge Parkway. If they travel at an average of 56 miles per hour, how long wil
    11·1 answer
  • An Internet service provider allows a certain number of free hours each month and then charges for each additional hour used. We
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!