1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ale4655 [162]
3 years ago
14

What is p-waves and s-waves known as..?

Biology
1 answer:
Mashcka [7]3 years ago
6 0

Answer: P-waves are known as congressional waves and S-waves are known as secondary waves.

Explanation:

You might be interested in
Which group of macromolecules is used for storing genetic information?
3241004551 [841]

Answer: Nucleus Acids

Explanation: Nucleic Acids hold and store DNA (think Nucleic/Nucleus)

8 0
3 years ago
Read 2 more answers
If instead of ACT, the first DNA triplet was ACG, which amino acid would be coded for?
BigorU [14]
<span>The answer is cysteine. This is a half essential proteinogenic amino acid with the formulation of HO₂CCHCH₂SH. It is prearranged by the codons UGU and UGC. The thiol side chain in cysteine frequently partakes in enzymatic responses, as a nucleophile.</span>
6 0
3 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
2 years ago
Some students at a middle school conducted a laboratory investigation to learn more about the physical properties of different e
TiliK225 [7]

Answer:

A

Explanation:

1. The colour is non metallic.

2. properties of metal solidness is not there, because of results of hammer experiment.

3. Physical consistency is not solid.

Etc.

4 0
3 years ago
British scientist who first observed cells under a microscope was _____
Sav [38]

Robert Hooke is the first person to observe cells as microscopic structures.

He was of British descent and, fun fact, he discovered cells by looking at a sliver of cork under a microscope lens (although the 'fun fact' is heavily simplified).

7 0
3 years ago
Read 2 more answers
Other questions:
  • The instructions for making proteins come originally from A) RNA. B) ribosomes. C) DNA. D) amino acids.
    11·2 answers
  • CHECK IF THE FIRST ONE IS RIGHT AND ANSWER THE SECOUND ONE Only answer if you know its right 13 POINTS :)
    15·2 answers
  • All of the following are found in a chloroplast EXCEPT?
    13·2 answers
  • A teacher cut an apple into three wedges of the same size. She dipped one wedge in lemon juice, dipped another in water, and lef
    10·2 answers
  • What condition occurs when hemoglobin is deprived of oxygen?
    12·1 answer
  • Which type of bond is formed in nitrogen gas?
    5·2 answers
  • Can natural resources be found everywhere on Earth?
    8·2 answers
  • All atoms are the same size and have the same amount of subatomic particles regardless of the element
    10·1 answer
  • The gas exhale during respiration​
    13·2 answers
  • An organism to obtain its nutrients is called a ____
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!