1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
BigorU [14]
3 years ago
6

Why do you think Hawaii has a “High” level of risk?

Biology
2 answers:
ivanzaharov [21]3 years ago
8 0
Hawaii has a “high” level of risk because there are volcano eruptions there and also earthquakes. Earthquakes are caused by eruptive processes within the active volcanoes or by deep structural adjustments due to the weight of the islands on Earth's underlying crust.
Sloan [31]3 years ago
7 0

Because, I think it has a risk since they have volcanoes there. And because they can get bad earthquakes also.

You might be interested in
Gastropods have a “vertebrate eye”—a highly advanced visual system.
enyata [817]
1._false
2._true
3._false
4._false
5._false the are Arthropods
6._true
7._false
<span>8._true</span>
5 0
3 years ago
Because individuals in a population usually tend to produce more than one offspring,
Zarrin [17]
The answer would most likely be B, this is because the more animals that are birthed, the more that will live and grow (assuming that they have enough resources for them).
Hope this helps!
7 0
3 years ago
Read 2 more answers
In which phase of clinical trials is the experimental drug tested on 100 to 500 volunteers with the medical condition or illness
Alik [6]

Phase II of clinical trial.

Explanation:

Clinical trials aim to determine the efficiency of a proposed or experimental drug on people before it is finalized and sold into the market.

This is necessary so that the effectiveness and any side effects of the drug could be assessed before hand.

The clinical trial design explains four phases :

Phase I involves trial of the experimental drug on healthy people who come for the trial with own consent. They are paid for the trials.

Phase II involves  comparing the effects of drug with general treatment. In this stage hundreds of effected people receive the drug and another group of hundreds of effected people receive the placebo.

Phase III involves testing of the drug on thousands of patients.

Phase IV involves taking reviews on the effectiveness of the drug. This stage comes after the drug has been released into the market. Any kind of ban on a drug can be imposed at this stage.

7 0
3 years ago
The skin is the primary organ of the<br> system?
Olin [163]

Answer:

The skin is an organ of protection

Explanation:

The primary function of the skin is to act as a barrier. The skin provides protection from: mechanical impacts and pressure, variations in temperature, micro-organisms, radiation and chemicals.

6 0
4 years ago
Read 2 more answers
Cell signaling involves converting extracellular signals to specific responses inside the target cell. Different molecules are i
uranmaximum [27]

Answer:

Each cell can receive and respond to signals that they get from their surroundings. The three stages involved in transduction are reception, transduction, and response.

Reception: It involves receptor molecules and inducers. Receptors can be intracellular or extracellular. Receptors like G- protein-coupled receptor, receptor tyrosine kinase, and signaling molecules are the items that come under reception.

Transduction: In transduction, signals are transferred from outside of the cell to the inside of the cell. Secondary messengers are majorly involved in signal transduction like cAMP, cGMP, IP3, Ca2+, nitric oxide, etc.

Response: The response of cell signaling includes processes like protein synthesis, cell division, cell growth, etc.

7 0
4 years ago
Other questions:
  • Which of the following makes data analysis easier?
    14·2 answers
  • Transcription creates an mRNA molecule using DNA as a template. Where does this occur?
    12·1 answer
  • Describe the methods used for illustrating weather forecasts.
    5·2 answers
  • Describe the prosedure of Lipo Cavitation in detail
    15·1 answer
  • Pairs of identical chromatids are attached to each oher at
    5·1 answer
  • two scientists do not agree on which type of grocery bag is better for the environment what is the most likely outcome of this d
    12·1 answer
  • Which cycle describes the movement of water above, on, and below the surface of the earth?
    15·1 answer
  • Most tropical storms which could become hurricanes form over the ocean near the equator. Which statement helps to explain the fo
    12·2 answers
  • Define aerobic respiration
    9·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!