1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MakcuM [25]
3 years ago
6

What is the microclimate of a hilltop like?

Biology
2 answers:
Angelina_Jolie [31]3 years ago
5 0
The higher you go on a hill the colder it gets, so its likely that the hilltop would be very cold, depending on the size.
Scilla [17]3 years ago
3 0
<span>A microclimate is the climate of a small area that is different from the area around it. It may be warmer or colder, wetter or drier, or more or less prone to frosts.Microclimates may be quite small – a protected courtyard next to a building, for example, that is warmer than an exposed field nearby.</span>
You might be interested in
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
What term refers to cell division in eukaryotic cells?
Grace [21]

Answer:

Mitosis

Explanation:

Mitosis is a process of nuclear division in eukaryotic cells that occurs when a parent cell divides to produce two identical daughter cells

7 0
3 years ago
The three most widely used psychoactive drugs in the world are
dem82 [27]
Alcohol,nicotine, and caffeine.
7 0
3 years ago
Read 2 more answers
120cm equal how many m
Volgvan

Answer:

120 centimeters equals 1.2 meters

5 0
3 years ago
What is the only non-Australian marsupial?
Alex

koala

the koala lives in the forest Australia has no forests they all burnt down

8 0
3 years ago
Other questions:
  • The Gajasimha in Indian mythology is a magical creature with the body of a lion and head of an elephant. A cross between a blue
    8·1 answer
  • What type of receptors embedded in the urinary bladder wall initiate the micturition reflex?
    7·1 answer
  • (c)Why was no starch found in:(i)the part of the leaf labelled A................................................................
    5·1 answer
  • Renewable resources are resources that can be replaced faster than they are used. Which of the following energy resources is ren
    11·1 answer
  • What human activity destroys the most natural animal habitats
    6·2 answers
  • Blood vessels that absorb strong pressure pulses contain more of this type of tissue.
    15·1 answer
  • Scientists lack enough evidence to conclude how the first organic molecules formed or arrived on
    14·1 answer
  • Hello please help i’ll give brainliest
    10·1 answer
  • Here is a picture lolz
    5·2 answers
  • a doctor examines the solid waste of a patuient which would most likely be evidence that the person is not digesting food correc
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!