1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KengaRu [80]
3 years ago
5

Alone in the woods, Pedro hears a noise. He thinks he sees a bear coming toward him. His heart starts pounding and then, a momen

t later, he realizes how frightened he is. This sequence of events is BEST explained by the _____ theory of emotion.
Biology
2 answers:
Sunny_sXe [5.5K]3 years ago
5 0

Answer:

<h2>James-Lange</h2>

Explanation:

Carl Lange and William James were a great scholar that developed a theory that is known as James- Lange theory. This theory explains physiological arousal and its relation to the emotion. According to this theory, a physiological change is the main thing and the emotion is the result of brain interaction. In the case of Pedro, first of all he shows physiological changes such as fear and some other things, so this theory is best to explain his condition.

pishuonlain [190]3 years ago
3 0
<h2>Cannon -Bard theory</h2>

Explanation:

  • Alone in the woods, Pedro hears a noise. He thinks he sees a bear coming toward him. His heart starts pounding and then, a moment later, he realizes how frightened he is. This sequence of events is BEST explained by the <u>Cannon-Bard t</u>heory of emotion.

According to Cannon-Bard theory, all the emotional expressions occur due to the stimulation of hypothalamic structures present in brain. This theory also states that feeling and physiological effects of an emotional stimuli occurs simultaneously.

Here, James thinks that a bear is coming, this is a stimulus. His heart starts pounding that is the physiological effect of the stimulus and the next moment he feels frightened which is a feeling.

So we conclude that in this case, the physiological effect and feeling of emotion occurred simultaneously. So these sequence of events is best explained  by Cannon-Bard's theory.

You might be interested in
What are some examples of metabolic processes in cells? (Choose all that apply)
luda_lava [24]

Answer:

Metabolism is a set of chemical reactions that  they release energy for cellular processes.

Explanation:

Metabolic processes in cells are:

* Metabolism-the whole of all chemical processes, that is, the total turnover of matter and energy is called metabolism.

* Cellular respiration-a process in which organic matter is oxidized, whereby carbon dioxide, water, and energy in the form of ATP molecules are formed as end products of this oxidation.

4 0
3 years ago
Which of the following statements about prey choice is not correct?
gogolik [260]

Answer: d. Predators avoid prey that are in their prime in order to maintain a high reproductive rate in the prey population, and hence 'grow' prey for the future.

Explanation:

A predator can be define as an organism superior and strong enough to kill inferior and weaker organism. This organism kill other organism to obtain it as food. A prey is an organism which is weak and cannot defend itself from the attack of the superior organism.

d. is the correct option. This is because the predators do not bother about the age and strength of the prey. They attack over them whether the prey is weak , young, prime, or old and try to obtain it as food.

8 0
3 years ago
Nose color is an inherited trait in dogs. Two puppies from the same set of parents have different color noses. One puppy has a p
blagie [28]

Answer: B

Explanation:

5 0
3 years ago
4. Root cells of plants take in some minerals from the surrounding soil by spending
shusha [124]

Answer:

i know its 3

Explanation:

yes buddy

6 0
3 years ago
The visceral motor division of the PNS is also called the autonomic division. Which of the following are functions of this divis
Likurg_2 [28]

Answer:

Muscles

Explanation:

Muscles

4 0
3 years ago
Read 2 more answers
Other questions:
  • A/an __________ may involve anything from a minimal exchange of information to extensive contact with the birth mother before an
    8·1 answer
  • Type of material transport that requires energy from the cell
    11·1 answer
  • Activated CD8 cells will mount a direct attack on target cells through the action of ____________ , which punch holes in membran
    5·1 answer
  • Which best describes the effects of hurricanes?
    10·2 answers
  • Which words or phrases describe some advantages of nonrenewable resources? Check all that apply.
    9·2 answers
  • Directions: Part 2 - Write your own skin scenario with FIVE or more sentences, using a completely different scenario than your 1
    9·1 answer
  • An object has a mass of 15 g and a volume of 5cm3. what is the density of the object?
    7·1 answer
  • Which of the following characteristics are expected in the first animals to have colonized land?
    8·1 answer
  • Nutrients are transported to the organs of the bloodstream by which system
    5·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!