1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mrrafil [7]
3 years ago
11

When a flu virus enters the body, the immune system creates antibodies made of polypeptide chains to fight the virus. The specif

ic shape of the protein allows it to bind to the virus and deactivate it. How does the antibody's primary protein structure create the specific shape to bind to flu viruses?
Biology
1 answer:
Otrada [13]3 years ago
6 0

Answer and explanation:

Antibodies are structures made of four polypeptides, <em><u>two light (L) chains and two heavy (H) chains that join together and form a molecule shaped like a "Y"</u></em>. This structure is possible thanks to the <u>disulfide bonds</u> that bind light chains and heavy chains together. While the stem of the Y is constant and doesn't change ("<em>constant region</em>"), the tips of the Y, composed of 110-130 amino acids and called "<em>the variable region</em>", vary greatly among the different antibodies and are responsible for the high specificity of these molecules.

<u>This is why we could say that the primary structure of this protein is given by disulfide bridges that twist the antibody and allow it to bind to a protein from the flu virus.</u>

You might be interested in
Many farmers select their cattle for breeding, but some farmers allow natural breeding to occur. The Jersey sire on this farm wa
ycow [4]
<span>2) higher genetic variation among the offspring</span>
6 0
3 years ago
Read 2 more answers
How can natural selection affect a predator-prey relationship?
wel
Predators and prey are both in a constant struggle for survival, foxes with bigger ears tend to catch more mice, and live longer, because of this, foxes with smaller ears don't live as long, pretty soon all foxes have larger ears. The same goes for prey, Mice with padded feet live longer due to the foxes having more trouble hearing them, pretty soon all mice have padded feet, and the cycle continues.
8 0
3 years ago
A client is admitted with thrombocytopenia. which specific nursing actions are appropriate to include in the plan of care for th
Brums [2.3K]
Avoid intramuscular injection,Examine the skin for ecchymotic areas
5 0
3 years ago
suppose 2 people smoke 5 cigarettes a day for 20 years. one develops lung cancers. will the other person definitely develop lung
Alchen [17]
Not nesserily its just luck
4 0
3 years ago
Read 2 more answers
All but one factors plays a part in water movement in and out of the cell
murzikaleks [220]
What are the functions of proteins within your body?
4 0
3 years ago
Other questions:
  • An example of negative feedback is the what in the body temperature if it gets too cold outside
    15·1 answer
  • Which is the best example of a scientific discovery resulting from new technology?
    13·2 answers
  • A female adolescent reports dryness and itchiness in the genitals along with thick, white cottage cheese like discharge. the lab
    13·1 answer
  • Pepsin begins the breakdown of _______ into _______.
    14·1 answer
  • After taking antibiotics for several weeks, a patient develops a severe bacterial infection in his intestines. The doctor claims
    15·2 answers
  • The heavier the object the _____________________ _____________________ it has if it has the same velocity at all masses.
    10·1 answer
  • Which of the following would change the allele frequencies of a
    9·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • The possession of one or more extra sets of chromosomes (relative to an ancestral condition) is called __________.
    14·1 answer
  • For the following problem use: It takes 100 years for half of the radioactive element
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!