1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anastasy [175]
4 years ago
14

When conditions in the environment change, a lack of genetic diversity may be disadvantageous for organisms that reproduce _____

_____. Genetic diversity may be advantageous for organisms that reproduce when conditions in an environment change.
Biology
1 answer:
Kamila [148]4 years ago
3 0

Answer:

  • When conditions in the environment change, a lack of genetic diversity may be disadvantageous for organisms that <u>reproduce asexually</u> . Genetic diversity may be advantageous for organisms that reproduce when conditions in an environment change.    

Explanation:

  • Each organism is required to have a specific set of factors that are required to produce more healthy offspring, as for the asexual reproduction to be carry out by the certain organisms there is a priority of having a more diverse form of environment for the organisms to carry out there reproduction or else it will derail there whole rate of producing healthy offspring.
You might be interested in
Directions Make a list of objects, products, and any other items around your house where plants were involved in the production
Blababa [14]

Answer:

-20 items-

Bed

Cat

Dog

desk

water

stove

oven

chair

toilet

shirt

shampoo

shoes

backpack

food

socks

paper

pencil

table

mask

towel

If Plants no longer existed on earth then there would be no way for carbon dioxide to be converted into oxygen, without oxygen animals and humans alike would die. The Worlds "Air" would be toxic for us to breathe, we need plants to survive. Without plants, animals would die of starvation, and predators would as well without substance.

3 0
3 years ago
Which of the following is a human -Made factor that can change climate?
lora16 [44]
The answer to this is C. Industry. It's the only man made factor. 
5 0
4 years ago
Read 2 more answers
Help me please
Mars2501 [29]
They did it to get more detailed pictures of space
6 0
4 years ago
Some laboratory mice are spotted, due to a dominant gene. Solid color is recessive. A solid color female mouse is mated to a spo
lorasvet [3.4K]

Answer: percentage of mice that will be spotted is 100%, and 0% chance of being solid colored.

Explanation:  First, homozygous means each parent have matching chromosomes (Like XX, instead of Xx)

Lets make a punnet square and show the data. We will use 'S' for spotted and 's' for solid

The punnet square shows that the percentage of mice that will be spotted is 100%, and 0% chance of being solid colored.

Hope this helps :)

5 0
3 years ago
What is the lowest value of the range of the function shown
liraira [26]

Answer:

The lowest value is -3.

Explanation:

5 0
3 years ago
Other questions:
  • A phosphodiester bond is used to: A. join two glucose molecules. B. join two nucleotides into a polynucleotide. C. join glycerol
    8·1 answer
  • Which of the following behaviors allows a bird to maintain a constant body temperature in extremely hot weather?
    14·2 answers
  • What is a function of the ground tissue of a root
    13·1 answer
  • What cell structure is composed of a stack of slightly curved saccules that are important in packaging and secretion?
    13·1 answer
  • Which type of protein, embedded in the plasma membrane, aids reactions of molecules that arrive?
    7·2 answers
  • Most water molecules cannot freely cross the cell membrane. True or false?
    13·2 answers
  • What are 3 parts of the nucleotide​
    5·2 answers
  • An object must be wider than 550 nanometers to be seen with<br> a ____ microscope
    8·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • What is produced from the electron transport chain?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!