Answer:
breathing and leg exercises
Explanation:
Based on the information provided within the question it can be said that the most appropriate to include in the client's postoperative plan of care would be to make sure complete their deep breathing and leg exercises. This is because after these surgeries the individual will be on bed rest, thus limiting their activity and putting them at risk for respiratory problems as well as deep vein thrombosis. Therefore doing these exercises will help prevent these complications.
Answer:
Amphibians begin their lives as eggs, The few eggs that get fertilized, and survive will hatch in 7-9 days. After the eggs of an Amphibian hatch they are called Tadpoles. Tadpoles breathe through gills like fish. ... Metamorphosis is the final process that changes the amphibian from tadpole to adult.
Explanation:
1. I studies this in 7th grade and remeber every single bit of it (monte vista)
2. Google
The exchange of genetic material between non-sister chromatids that may result in new gene combinations on the chromosomes is called the random assortment. It involves formation of random combinations of chromosomes in meiosis and of genes on different pairs of homologous chromosomes by the passage according to the laws of probability of one of each diploid pair of homologous chromosomes into each gamete independently to each other pair.
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
