1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lesya [120]
3 years ago
12

Help please Can u define it on your own words please THANK YOU

Biology
1 answer:
tresset_1 [31]3 years ago
6 0
<span>Allergy-
A medical condition that causes someone to become sick after eating, touching, or breathing something.

Allergen
A substance or object that causes allergies.

Hope this helps!!

</span>
You might be interested in
This is an example of a frameshift mutation.
DedPeter [7]

I dont know pls but I am a kid and I am not a fan of british eas but I am not sure if you can get a girl from a girl or wut you are saying that you are not going to be a part of the world but you can 5also it launched the first of a number one do not

8 0
3 years ago
5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
drek231 [11]

the complementary strand would be 5' TACGGGCCCACAGCATCAACT3'

the complementary strand would be this sinceyoujust switch the letter in the strand out for its pair when looking for a comlementry strand

so for reference heres a little cheat guide

Adenine=Thymine

Thymine=Adenine

Guanine=Cytosine

Cytosine=Guanine



5 0
3 years ago
How many square feet of outdoor carpet will we need for this hole? Iready quiz pic
STALIN [3.7K]

4 \times 12 = 48
3 \times 2 = 6 \\ 2 \times 1 = 2 \\ 6 + 2 = 8
48 - 8 = 40
it needs 40 feet for the carpet.
hope this helps
3 0
3 years ago
High carbon dioxide concentration in body fluids is called
lesya [120]
It is called death when you have to much carbon dioxide

7 0
3 years ago
If an atom of sodium has 11 protons, what is its approximate atomic mass?
Damm [24]
If you add the amount of protons with the amount of neutrons, you get the atomic mass. Sodium has 11 protons, and 12 neutrons. 11+12=23

4 0
3 years ago
Other questions:
  • Does the distribution of bases in sea urchin dna and salmon dna follow chargaff's rules?
    11·1 answer
  • A fossil can be studied to learn __________.
    13·1 answer
  • How do scientists use radioactive decay to date fossils
    13·1 answer
  • Which of the following is not found in poultry?
    8·1 answer
  • Compare and contrast the modes of action of lipid-soluble and water-soluble hormones.
    8·1 answer
  • Why is it a competitive advantage for a plant to be taller (9th grade biology homework)
    12·1 answer
  • A box 10 centimeters high, 5 centimeters long, and 5 centimeters wide. Find the volume of a box with a length of 5 cm, a width o
    12·1 answer
  • Mitosis makes? sperm and egg cells. identical body cells. or all cells
    13·1 answer
  • Find 4 digit code escape room
    12·1 answer
  • an __ involves an inherited dispition to activate specvific behavior patterns that enable an organism to reach specific goals
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!