Answer:
Which of the following is not a type of endocytosis?
constitutive secretion
Explanation:
There are only three types of endocytosis namely; phagocytosis, pinocytosis and receptor-mediated endocytosis
Fluid mosaic is a term used to describe the current model of the cell membrane. Cell membranes are basically double layers (bilayers) of molecules called phospholipids.A mosaic is a structure made up of many different parts.<span> Mainly because of the way the plasma membrane is made up. It is fluid because it can wave and wobble like fluid, a bit sticky though. Due to the phospholipids sticking together. It is called mosaic because there are various proteins stuck inside the fluid creating a kind of patchwork or mosaic </span>
Capillaries are one cell thick and so this makes them very thin. capillaries are also arranged in networks known as capillary beds, and thus multiple capillaries are spread over a large area.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation: