1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
leonid [27]
3 years ago
8

An LED lightbulb has an efficiency of 11,5% and a power of 10 W. How much

Biology
1 answer:
Lelechka [254]3 years ago
5 0

The light bulb produces 1.15 J  energy in 1 second.

<u>Explanation:</u>

Efficiency of an electric appliance is defined as the ratio of output power to the input power. In a 100% efficient appliance all of the input power will be converted to output power. In the given question  it is given that

input power= 10W  

efficiency= 11.5%

(output power)/(input power)=efficiency  

output power = input power * efficiency

=10 \times (11.5/100)=1.15W

Now we have to calculate the energy produced by the light bulb in 1 second

energy=power \times time

=1.15 \times 1

=1.15J

You might be interested in
CAN I GET ANSWER OF 2 AND 4​
Marta_Voda [28]

Explanation:

2.spirogyra

4.porifera

7 0
2 years ago
Which of the following is not a type of endocytosis? phagocytosis pinocytosis receptor-mediated endocytosis constitutive secreti
astraxan [27]

Answer:

Which of the following is not a type of endocytosis?

constitutive secretion

Explanation:

There are only three types of endocytosis namely;  phagocytosis, pinocytosis and receptor-mediated endocytosis

8 0
3 years ago
Explain what a mosaic is and then explain why the term fluid mosaic model is used to describe the plasma membrane
zalisa [80]
Fluid mosaic is a term used to describe the current model of the cell membrane. Cell membranes are basically double layers (bilayers) of molecules called phospholipids.A mosaic is a structure made up of many different parts.<span> Mainly because of the way the plasma membrane is made up. It is fluid because it can wave and wobble like fluid, a bit sticky though. Due to the phospholipids sticking together. It is called mosaic because there are various proteins stuck inside the fluid creating a kind of patchwork or mosaic </span>
7 0
3 years ago
Describe how the capillaries are adapted to allow this process to happen efficiently.
Svetach [21]
Capillaries are one cell thick and so this makes them very thin. capillaries are also arranged in networks known as capillary beds, and thus multiple capillaries are spread over a large area.
7 0
3 years ago
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • Witch one is the answer
    13·1 answer
  • What is the main function of structural adaptations? A. They help the organism survive in its environment. B. They help the orga
    14·1 answer
  • 14 Hypothesize What would happen to the ecosystem<br> if there were no nitrogen-fixing bacteria?
    5·1 answer
  • What type of stress in placed on <br> Folds
    5·1 answer
  • Checking for contents of the intestinal tract would be done during which phase of the autopsy?
    9·2 answers
  • He creationist and evolutionist are in agreement on all of the following items except:
    11·1 answer
  • List four functions of protein
    6·2 answers
  • Table salt and table sugar, examine the chemical formulas for salt and sugar. What do they tell you about what type of bonding i
    8·1 answer
  • A lot of the debate around genetically modified organisms is concerned with whether or not it is morally right or wrong to modif
    6·1 answer
  • A dichotomous key can be used to identify an unknown organism. What is the most likely common name of the fish in the picture?:
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!