1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andrei [34K]
3 years ago
15

Which is a possible outcome of global warming

Biology
2 answers:
CaHeK987 [17]3 years ago
7 0
Extinction to different animal species, could vause forest fires and destroy animal habotats therefor becoming extinct, could over heat water causing algae to form on the top not letting sunlight through for plants to photosynthesize which doesnt give fish the nutrients they need to survive.
Harlamova29_29 [7]3 years ago
6 0
2 possible outcomes of global warming is climate change and rising temperatures as well. Hoped that helped!!!
You might be interested in
How to prevent pregnancy implanted progestins contained in porous silicone?
11111nata11111 [884]

Hello,


To prevent pregnancy implanted progestins contained in porous silicone tubes are inserted under the skin.


Hope this helped,

j548831

5 0
2 years ago
Identify the phase of the moon labeled C that would be seen from the earth labeled B
mariarad [96]

Answer:

The correct answer is - a lunar eclipse (total lunar eclipse).

Explanation:

When the sun and moon align opposite one another and earth between them and blocks the light of the sun to reach the moon known as a lunar eclipse. A lunar eclipse can be a partial or total lunar eclipse.

A partial lunar eclipse occurs when a part of the earth covers the moon to get the light or between the sun and the moon. The total lunar eclipse occurs when the whole moon is opposite to the sun and earth between them.

5 0
3 years ago
Yay Sachs disease is a disorder characterized by an accumulation of fatty substances called gangliosides in the brain and spinal
Ratling [72]
<h2>dont know what your asking?</h2><h2></h2><h2></h2><h2></h2>
6 0
2 years ago
In the reaction B+ K2L+H, if an additional B is added, the result will be
stepan [7]

This should help you I hope the answer is right!

8 0
3 years ago
What is the energy that is captured during photosynthesis used to produce?
Semenov [28]

Answer:

The Answer is c. sugar

Explanation:

because plants use photosynthesis to make sugar to survive.

3 0
3 years ago
Other questions:
  • 50 POINTS!!! For anyone who wants to do an experiment because I got plenty of other projects to work on xD. It would be super he
    13·2 answers
  • (WILL MARK BRAINIEST)Which is required for both anaerobic respiration and aerobic respiration? A:oxygen B:water C:mitochondria D
    7·2 answers
  • 1. What is the Zone of Inhibition in this image:
    9·1 answer
  • I need help with these questions!! (Biology) 28 Points!!
    5·1 answer
  • The type of waste in most landfills is ​
    13·1 answer
  • When does cell differentiation occur? Question 1 options: when cells express the same gene when cells express different genes wh
    5·1 answer
  • Ecosystems include food webs that show predation and prey interactions among organisms. But ecosystems have many more relationsh
    11·1 answer
  • Scientists have changed the DNA of a type of cabbage so that it contains a tiny amount of poison from a scorpion’s tail. The poi
    9·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Which of the following undergo meiosis?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!