Answer:
Sympatric speciation.
Explanation:
Sympatric speciation is a type of speciation that occurs when 2 types of groups of the common species live in the common geographic location, but they grow differently until they can no longer interbreed and are known as different species.
This speciation can occur in different types of species such as bacteria, the apple maggot fly, and cichlid fish, but it is difficult to tell when this speciation is happening or has occurred in nature. There are four types of speciation occurs:
1) Symmetric
2) Allopathic
3) Parapatric
4) Peripatric.
Answer;
Kingdom, Division, Class, Order, Family, Genus and Species
Explanation;
-The plant kingdom is divided into three divisions namely Bryophyta, Pteridophyta and Spermatphyta.
-Division Bryophyta includes mosses and liverworts. Division Pteridophyta includes the ferns and horsetails. They show a greater variety and a greater ability than bryophyte.
-Division Spermatophyta comprises all the seed bearing plants. They are familiar green plants which produce seeds through flowers or cones. The division spermatophyte consists of two main subdivisions: Gymnospermatophyta and Angiospermatophyta, which are the divided into classes and so forth,.
I think it’s money sorry if I’m wrong
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Explanation:
Natural selection is the mechanism that is responsible for the evolution of organisms.
In the given case, the Freshwater shrimp has been introduced to a pond in which the two species with variations are introduced.
The <em>C. cantonensis </em>is brighter in color whereas the <em>C. multidentata</em> is mottled drab in color. The predator fish can feed easily on the species which is brighter therefore <em>C. cantonensis</em> is more susceptible. The mottled drab species is not easily predated by the species.
The 30 % offsprings of <em>C. cantonensis</em> can survive till the reproductive age whereas 75% of C. multidentata. This shows that natural selection has acted on the color of the shrimp species selected against the predator fish species.
The species with mottled drab color is the result of the differential reproductive rate.
