1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nady [450]
3 years ago
8

The particles in a hot pan have ____________ kinetic energy than the particles in a cool oven mitt.

Biology
2 answers:
aleksandrvk [35]3 years ago
7 0
The particles in a hot pan have greater kinetic energy than the particles in a cool oven mitt.

This is because as the temperature of an object increases, the particles gain more energy and therefore move faster, increasing kinetic energy.

I hope this helps, feel free to ask any questions you may have
kirza4 [7]3 years ago
4 0

Answer:

greater kinetic energy

Explanation:

You might be interested in
Think about a bush in your backyard. Is it alive according to the characteristics of life? Why or why not ?
Allushta [10]

Question: Think about a bush in your backyard. Is it alive according to the characteristics of life? Why or why not ?

Answer: its alive

Explanation: It performs all necessary life functions to survive which are respiration, reproduction,transpiration and etc

question answered by

(jacemorris04)

6 0
3 years ago
9. Which of the molecules is hardest for your body to digest and is the unhealthiest?
amid [387]
I think it’s fats. Let me know.
3 0
2 years ago
Como se producen las células?
uysha [10]

Se crean nuevas células a partir de un proceso llamado división celular. Las nuevas células se producen cuando una célula, llamada célula madre, se divide en nuevas células llamadas células hijas.

 

5 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
What is the final result of mitosis in a human?
Scorpion4ik [409]
A. genetically identical 2n somatic cells
6 0
3 years ago
Other questions:
  • (multiple choice) Daytime temperatures on Mercury are extremely hot because:
    12·2 answers
  • Diseases caused by pathogens are also generally known as?
    10·2 answers
  • Where do most of the oceans animals and plants live in the ocean
    12·2 answers
  • How might genetic drift be important in managing an endangered species?
    12·1 answer
  • Which of the following is found in the 'rungs' of a DNA strand?
    8·1 answer
  • HELP PLZ ASAP GIVING BRAINLIEST!!
    14·1 answer
  • A ________ is an educated guess based on relative information that has been collected.
    9·2 answers
  • A day on Earth is approximately 24 hours, which is the amount of time it takes for Earth to complete one
    7·1 answer
  • What is biological success
    10·1 answer
  • Explain why the northern hemisphere receives more solar energy from the sun between june and august than the southern hemisphere
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!