1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
borishaifa [10]
3 years ago
14

Plz help I will mark you brainlist plz help ​

Biology
1 answer:
mina [271]3 years ago
8 0

Answer:

By running them under water. The water will separate the rocks from the dirt.

You might be interested in
Name two types of nucleus found in paramecium? ​
zloy xaker [14]

Answer:

micronucleus and macronucleus

4 0
3 years ago
Read 2 more answers
How is cell differentiation different than mitosis?
erastovalidia [21]

Cell differentiation is the process by which cells specialize to achieve their required functions. In order for a cell to differentiate, it will express specific genes. ... Importantly, mitosis produces cells that are identical to each other (clones).

8 0
3 years ago
Studies have shown that there is a relationship between the type and location of boundaries and the distribution and depth of ea
Andre45 [30]

Answer:

The correct answer is B. <em>Philippine plate converging with the Pacific plate, forming Mariana Islands in the Pacific Ocean</em>

Explanation:

When two oceanic plates collide, it occurs oceanic convergence. The thicker and older plate subduces under the other plate, and at this point, it starts the volcanic activity. As the thicker plate descends, it is heated and melted and its materials are incorporated into the mantle. The fast subduction originates magma that ascends to the surface by crevices. This makes place to the formation of grouped volcanic islands, the island arches. Subduction zones coincide with deep-sea trenches or depressions in the ocean bed. The volcanic islands are arranged in a circumference arch shape, which is bordered by a fossa. Most of these are located in the western Pacific, where the pacific crust is older and thicker, and hence it submerges easier in the mantle.

The Mariana Islands in the Pacific Ocean are examples of these volcanic islands.                  

3 0
4 years ago
Read 2 more answers
How do environmental scientists use technology to track polar bears?
sukhopar [10]

Answer:

Environmental Scientists can use GPS tagging

Explanation:

3 0
4 years ago
Read 2 more answers
Need help plzzzzzzzzzz
lyudmila [28]

I'm not 100% sure, but

1.) prokaryotic

2.) prokaryotic

3.) eukaryotic

4.) prokaryotic

6 0
3 years ago
Read 2 more answers
Other questions:
  • How do fungi break down leaves, fruit, and other organic material into simple molecules?
    11·1 answer
  • Turtles are higher on the _____ than insects?
    7·1 answer
  • Click to review the online content. Then answer the question(s) below, using complete sentences. Scroll down to view additional
    14·1 answer
  • Is this single cell or multicellular ​
    13·1 answer
  • When would you expect volcanoes or volcanic islands to form? (Which 2 types of plates are colliding?)
    9·1 answer
  • Where is the epicenter of an earthquake?
    14·2 answers
  • When rounding to the nearest 10 what is the greatest whole number that rounds to 7670​
    9·1 answer
  • The place where V.B.Ketkar served as a school teacher for 25 years is:
    10·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • You are building a birdhouse when you cut your finger. Predict which body systems would be immediately involved with your reacti
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!