Mitosis is the division that results in two “daughter” cells. Both of these daughter cells have the same number of chromosomes as the “parent” cell.
Mitosis consists of 4 phases: prophase, metaphase, anaphase, and telophase.
Prophase: the DNA is copied and the chromosomes pair up
Metaphase: the chromosomes line up in the middle of the cell
Anaphase: sister chromatids are pulled apart from each other towards opposite sides of the cell
Telophase: the cell begins to pinch in the middle and separates into two identical daughter cells
Answer:
a. spore
Explanation:
Fungi is a kingdom in which you can fund yeast, mold, and all kind of fungus, microcellular, and monocellular ones.
The way fungi reproduction is through spores that get distributed in a latent way until thy fund its necessary conditions to living.
These spores can create both ways, sexual and asexual.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Answer:
which weather map are you talking about
