1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pantera1 [17]
3 years ago
10

Select the correct answer.

Biology
1 answer:
makkiz [27]3 years ago
6 0

Answer: A. bacteria

Explanation: because we know that nitrogen fixingbacteria's fix as ammonia to made available for the plants

You might be interested in
What is the point of extending the life on an 88 year old man with advanced prostate cancer?
bogdanovich [222]
Taking proper medicine or getting surgery
7 0
3 years ago
What can be said about the diversity of life in the high tide zone compared to that of the low tide zone?
Airida [17]

Answer:

B. There is less biodiversity in the high tide zone because the tidal changes make survival difficult.

Explanation:

The high tide and low tide zones are located on the seashore as the ocean water merges with land.

High tide zones are usually covered with water during high ocean tide while low tide zones are always submerged in water.

There is low biodiversity in the high tide zone because the tide here changes rapidly and organisms find it difficult to adapt. Organisms that inhabit here must be welll adapted to withstand peroids of high tides.

4 0
4 years ago
Read 2 more answers
Why do you think surface waves are the slowest moving waves?
Arada [10]

Answer:

S waves are more dangerous than P waves because they have greater amplitude and produce vertical and horizontal motion of the ground surface. The slowest waves, surface waves, arrive last. They travel only along the surface of the Earth.

Explanation:

8 0
3 years ago
Read 2 more answers
The Krebs cycle forms many products. Which option lists the correct products of the Krebs cycle after 1 molecule of glucose goes
expeople1 [14]

Answer:

It's D I just took the quick check

Explanation:

8 0
3 years ago
Read 2 more answers
A zygote is the product of fertilization. The diploid zygotes of the four organisms seen here all underwent __________ and _____
Eva8 [605]
A zygote is the product of fertilization. The diploid zygotes of the four organisms seen here all underwent mitosis and differentiation in order to produce the four very different embryos. The differentiation of cells during embryogenesis is the key to cell, tissue, organ, and organism identity. Once an egg is fertilized by a sperm, a zygote is formed. The zygote divides into multiple cells by mitosis, triggering the beginning of embryonic differentiation. <span />
3 0
3 years ago
Read 2 more answers
Other questions:
  • Why is the Circum-Pacific belt shown on this map called the Ring of Fire? A fire burns continuously there.
    7·2 answers
  • Plant photosynthesis and the consumption of plants by animals is best explained by what unifying principle of life? A) All livin
    10·1 answer
  • Rosalind Franklin's x-ray diffraction images of DNA gave James Watson and Francis Crick information about DNA's
    9·1 answer
  • Why is a shell considered to be biotic?
    6·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • Which of these is true about inherited traits?
    9·1 answer
  • During a(n) _____________________, the sun can produce excessive radiation to heat the lower atmosphere and Earth's surface.
    8·1 answer
  • Makes ATP,CO2 and water<br><br> Photosynthesis or cellular respiration or both of them?
    8·1 answer
  • In response to a threat, we perspire, breathe more quickly, get goose bumps, and feel nauseous. These responses are controlled b
    5·1 answer
  • Answer me:
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!